Skip to main content
. Author manuscript; available in PMC: 2024 Jul 24.
Published in final edited form as: Curr Biol. 2023 Jul 14;33(14):3056–3064.e5. doi: 10.1016/j.cub.2023.06.051

Key resources table.

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
Polyclonal rabbit anti-GFP primary antibody Novus Biologicals NB600-308
Alexa Fluor 488-conjugated goat anti-Rabbit IgG secondary antibody ThermoFisher A11034
Bacterial and virus strains
Escherichia coli OP50-1 CGC N/A
Chemicals, peptides, and recombinant proteins
Protease from Streptomyces griseus Sigma P-6911
Vectashield with DAPI Mounting Medium for Fluorescence Vector Laboratories H-1200
S. pyogenes Cas9 (10ug/uL) IDT 1081058
Nuclease-free Duplex buffer IDT 11- 01-03-01
Invitrogen Wheat Germ Agglutinin, Tetramethylrhodamine Conjugate Fisher Scientific W849
Critical commercial assays
Zymo Direct-zol RNA MicroPrep kit Zymo Research R2061
LunaScript RT SuperMix kit NEB E3010S
Phusion high fidelity DNA polymerase NEB M0530S
Expand Long Template PCR system Roche 11681834001
NEBuilder® HiFi DNA Assembly Master Mix NEB E2621S
Miniprep kit Qiagen 27104
PCR purification kit Qiagen 28104
MinElute PCR purification kit Qiagen 28004
Gel extraction kit Qiagen 28704
LongAmp Taq PCR kit NEB E5200S
Competent cells NEB C2987H
KAPA HiFi HS+dNTPs (100U) Roche KK2501
KAPA Hyper Prep PCR-free (8rxn) Roche KK8501
AMPure XP beads Beckman Coulter A63880
Experimental models: Organisms/strains
C. elegans: Strain N2 Caenorhabditis Genetics Center (CGC) N2
C. elegans: Strain BA829 spe-36(it114) unc-22 Ken Kemphues, Cornell University BA829
C. elegans: Strain AD99 spe-36(as1) This study AD99
C. elegans: Strain AD105 spe-36(as6) This study AD105
C. elegans: Strain CB4856 Hawaiian mapping strain CGC CB4856
C. elegans: Strain DR466 him-5(e1490) CGC DR466
C. elegans: Strain BA17 fem-1(hc17) CGC BA17
C. elegans: Strain CB61 dpy-5(e61) CGC CB61
C. elegans: Strain AD348 glp-4(bn2); him-5(e1490) Cross between SS104 and DR466 AD348
C. elegans: Strain MDX44 cylc-2(mon2[cylc-2::mNG^3xFLAG]) Krauchunas et al., 202021 MDX44
C. elegans: Strain SL438 spe-9(eb19) I; him-5(e1490) V; ebEx126 CGC SL438
C. elegans: Strain RT36 arIs37 [myo-3p::ssGFP] Barth Grant, Rutgers University RT36
C. elegans: Strain HCL67 unc-119(ed3) III; uocIsl [eft-3p::Cas9(dpiRNA)::tbb-2 3′ UTR + unc-119(+)] CGC59 HCL67
C. elegans: Strain ARK5 spe-36(as6); asEx96 [PCR product of genomic spe-36] This study ARK5
C. elegans: Strain ARK6 spe-36(as6); him-5(e1490); asEx96 This study ARK6
C. elegans: Strain ARK7 spe-36(nwk1[spe-36::gfp]); him-5(e1490) This study ARK7
C. elegans: Strain ARK17 cylc-2(mon2); spe-36(as6); him-5(e1490); asEx96 This study ARK17
C. elegans: Strain AD349 asEx112 [myo-3p::spe-36::gfp] This study AD349
C. elegans: Strain AD350 asEx113 [myo-3p::spe-9::gfp] This study AD350
Oligonucleotides
PCR Primer for TruSeq library amplification, SG – 915 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGA Sam Gu, Rutgers University, designed by Illumina n/a
PCR Primer for TruSeq library amplification, SG – 916 CAAGCAGAAGACGGCATACGAGAT Sam Gu, Rutgers University designed by Illumina n/a
PCR Primer to amplify F40F11.4 plus 479 bp upstream and 303 bp downstream GGAAGAATGTAACGGCTGCTATC This study n/a
PCR Primer to amplify F40F11.4 plus 479 bp upstream and 303 bp downstream CCGGATTGAGGTTGGTGTTT This study n/a
PCR Primer to amplify spe-36 for Gibson assembly CCCACGACCACTAGATCCATCTAGAAAAAAATGAATTTCAAAATATGTATTCTGTTC This study n/a
PCR Primer to amplify spe-36 for Gibson assembly TCCTTTACTCATTTTTTCTACCGGTAACAATTCATCCATCTCTTCAG This study n/a
PCR Primer to amplify spe-9 for Gibson assembly CCCACGACCACTAGATCCATCTAGAAAAAAATGAATGTGATTCTGGTG This study n/a
PCR Primer to amplify spe-9 for Gibson assembly TCCTTTACTCATTTTTTCTACCGGTAAAAATGGATTCTCAGTTTTCAC This study n/a
PCR primers for RT-PCR can be found in Table S1
Oligos and RNAs for CRISPR can be found in Table S2
Recombinant DNA
PJF25 Barth Grant, Rutgers University57
myo-3p::spe-36::gfp (signal peptide replaced with spe-36 cDNA in PJF25) This study
myo-3p::spe-9::gfp (signal peptide replaced with spe-9 cDNA in PJF25) This study
Software and algorithms
MimodD https://mimodd.readthedocs.io/en/latest/
FUSION https://fusion.help.andor.com/display/fusionum/Introduction
Imaris https://imaris.oxinst.com/
Zeiss Zen https://www.zeiss.com/microscopy/en/products/software/zeiss-zen.html
GraphPad Prism https://www.graphpad.com/