KEY RESOURCES TABLE.
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
|
| ||
| Antibodies | ||
|
| ||
| Rabbit monoclonal anti-ATG5 (clone: D5F5U) | Cell Signaling Technology | Cat#12994; RRID: AB_2630393 |
| Rabbit monoclonal anti-ATG7 (clone: D12B11) | Cell Signaling Technology | Cat#8558; RRID: AB_10831194 |
| Rabbit monoclonal anti-Beclin-1 (clone: D40C5) | Cell Signaling Technology | Cat#3495; RRID: AB_1903911 |
| Rabbit polyclonal anti-SQSTM1/p62 | Cell Signaling Technology | Cat#5114; RRID: AB_10624872 |
| Rabbit polyclonal anti-TFEB | Bthyl Laboratories | Cat#A303-673A; RRID: AB_11204751 |
| Rabbit monoclonal anti-PUMA (clone: D7L9L) (Rodent Specific) | Cell Signaling Technology | Cat#24633, RRID: AB_2798879 |
| Rabbit polyclonal anti-Bax | Cell Signaling Technology | Cat#2772; RRID: AB_10695870 |
| Rabbit monoclonal anti-Bak (clone: D4E4) | Cell Signaling Technology | Cat#12105; RRID: AB_2716685 |
| Rabbit monoclonal anti-XIAP (clone: D2Z8W) | Cell Signaling Technology | Cat#14334; RRID: AB_2784533 |
| Rabbit monoclonal anti-phospho-c-Jun (Ser73) (clone: D47G9) | Cell Signaling Technology | Cat#3270; RRID: AB_2129575 |
| Rabbit monoclonal anti-c-Jun (clone:60A8) | Cell Signaling Technology | Cat#9165; RRID: AB_2130165 |
| Rabbit polyclonal anti-cleaved caspase-3 (Asp175) | Cell Signaling Technology | Cat#9661; RRID: AB_2341188 |
| Mouse monoclonal anti-WIPI2 | Bio-Rad | Cat#MCA5780GA; RRID: AB_10845951 |
| Mouse monoclonal anti-LC3 | MBL International | Cat#M186-3; RRID: AB_10897859 |
| Mouse monoclonal anti-Bcl2 (clone: C-2) | Santa Cruz Biotechnology | Cat#sc-7382; RRID: AB_626736 |
| Mouse monoclonal anti-GAPDH (clone:6C5) | Santa Cruz Biotechnology | Cat#sc-32233; RRID: AB_627679 |
| Mouse monoclonal anti-β-actin (clone:C4) | Santa Cruz Biotechnology | Cat#sc-47778; RRID: AB_626632 |
| Rat monoclonal anti-CD140a (PDGFRα) | Thermo Fisher Scientific | Cat#14-1401-82; RRID: AB_467491 |
| Rat monoclonal anti-CD140a (PDGFRα) (Clone: APA5) | BD Biosciences | Cat#558774; RRID: AB_397117 |
| Rat monoclonal anti-LAMP2 (clone: GL2A7) | Abcam | Cat#ab13524; RRID: AB_2134736 |
| Rat monoclonal anti-MBP | Abcam | Cat#ab7349; RRID: AB_305869 |
| Mouse anti-galactocerebroside (Galc) hybridoma | Emery and Dugas39 | N/A |
| Mouse monoclonal anti-Calbindin | Swant | Cat#CB38; RRID: AB_10000340 |
| AffiniPure goat anti-rat IgG (H + L) | Jackson ImmunoResearch Labs | Cat#112-005-003; RRID: AB_2338090 |
| Griffonia (Bandeiraea) simplicifolia lectin I (BSL I) | Vector Laboratories | Cat#L-1100; RRID: AB_2336491 |
| Peroxidase-AffiniPure goat anti-mouse IgG (H + L) | Jackson ImmunoResearch Labs | Cat#115-035-003, RRID: AB_10015289 |
| Peroxidase-AffiniPure goat anti-rat IgG (H + L) | Jackson ImmunoResearch Labs | Cat#112-035-167; RRID: AB_2338139 |
| Peroxidase-AffiniPure goat anti-rabbit IgG (H + L) | Jackson ImmunoResearch Labs | Cat#111-035-003; RRID: AB_2313567 |
| Donkey anti-rat IgG (H + L), Alexa Fluor 488 | Thermo Fisher Scientific | Cat#A-21208; RRID: AB_2535794 |
| Donkey anti-rat IgG (H + L), Alexa Fluor 594 | Thermo Fisher Scientific | Cat#A-21209; RRID: AB_2535795 |
| Goat anti-rat IgG (H + L), Alexa Fluor 488 | Thermo Fisher Scientific | Cat#A-11006; RRID: AB_2534074 |
| Goat anti-rat IgG (H + L), Alexa Fluor 555 | Thermo Fisher Scientific | Cat#A-21434; RRID: AB_2535855 |
| Donkey anti-rabbit IgG (H + L), Alexa Fluor 488 | Thermo Fisher Scientific | Cat#A-21206; RRID: AB_2535792 |
| Goat anti-rabbit IgG (H + L), Alexa Fluor 488 | Thermo Fisher Scientific | Cat#A-11008, RRID: AB_143165 |
| Donkey anti-rabbit IgG (H + L), Alexa Fluor 594 | Thermo Fisher Scientific | Cat#A-21207; RRID: AB_141637 |
| Goat anti-mouse IgG (H + L), Alexa Fluor 488 | Thermo Fisher Scientific | Cat#A-11001; RRID: AB_2534069 |
| Donkey anti-mouse IgG (H + L), Alexa Fluor 594 | Thermo Fisher Scientific | Cat#A-21203; RRID: AB_141633 |
|
| ||
| Chemicals, peptides, and recombinant proteins | ||
|
| ||
| DAPI | Thermo Fisher Scientific | Cat#D1306 |
| CellMask Blue Stain | Thermo Fisher Scientific | Cat#H32720 |
| Calcein AM | Thermo Fisher Scientific | Cat#C3100MP |
| Annexin V, Alexa Fluor 594 | Thermo Fisher Scientific | Cat#A13203 |
| Incucyte Annexin V Dye, Red | Sartorius | Cat#4641 |
| Propidium Iodide | Thermo Fisher Scientific | Cat#P3566 |
| SYTO13 Green Fluorescent Nucleic Acid Stain | Thermo Fisher Scientific | Cat#S7575 |
| L-Cysteine hydrochloride | Sigma-Aldrich | Cat#C7477 |
| cOmplete protease inhibitor | Sigma-Aldrich | Cat#5892791001 |
| PhosSTOP phosphatase inhibitor | Sigma-Aldrich | Cat#4906845001 |
| RIPA | Thermo Fisher Scientific | Cat#89900 |
| Amersham ECL Prime Western Blotting Detection Reagent | Cytiva | Cat#RPN2232 |
| SuperSignal West Femto Maximum Sensitivity Substrate | Thermo Fisher Scientific | Cat#PI34095 |
| 0.05% Trypsin-EDTA | Thermo Fisher Scientific | Cat#25300–054 |
| 2-Mercaptoethanol | Sigma-Aldrich | Cat#M6250 |
| Tamoxifen | Sigma-Aldrich | Cat#T5648 |
| Paraformaldehyde | Electron Microscopy Sciences | Cat#15710 |
| Glutaraldehyde | Electron Microscopy Sciences | Cat#16320 |
| Poly-D-lysine hydrobromide | Sigma-Aldrich | Cat#P6407 |
| Normal Goat Serum | Jackson ImmunoResearch Labs | Cat#005-000-121; RRID: AB_2336990 |
| Normal Donkey Serum | Jackson ImmunoResearch Labs | Cat#017-000-121; RRID: AB_2337258 |
| Dimethyl Sulfoxide | Sigma-Aldrich | Cat#D2650 |
| Bafilomycin A1 | Sigma-Aldrich | Cat#196000 |
|
| ||
| Critical commercial assays | ||
|
| ||
| Click-iT Plus EdU Alexa Fluor 594 Imaging Kit | Thermo Fisher Scientific | Cat#C10639 |
| RNAscope Fluorescent Multiplex Reagent Kit | ACDbio | Cat#320850 |
| RNAscope Multiplex Fluorescent Reagent Kit v2 with TSA Vivid Dyes | ACDbio | Cat#323270 |
| RNeasy Plus Micro Kit | QIAGEN | Cat#74034 |
| LunaScript RT SuperMix Kit | New England Biolabs | Cat#E3010S |
| Fast SYBR Green Master Mix | Thermo Fisher Scientific | Cat#4385612 |
| BCA Protein Assay Kit | Thermo Fisher Scientific | Cat#23227 |
|
| ||
| Deposited data | ||
|
| ||
| RNA-seq raw reads | This paper | NCBI BioProject: PRJNA986522 |
| The raw data of proteomics | This paper | MassIVE: MSV000092434 |
|
| ||
| Experimental models: Cell lines | ||
|
| ||
| Primary murine oligodendrocyte precursor cells | This paper | N/A |
|
| ||
| Experimental models: Organisms/strains | ||
|
| ||
| Mouse: C57BL/6J | Charles River | Strain #632; RRID: IMSR_JAX:000664 |
| Mouse: ATG5Flox: B6.129S-Atg5<tm1Myok> | RIKEN | Strain #RBRC02975; RRID: IMSR_RBRC02975 |
| Mouse: ATG7Flox: B6.Cg-Atg7<tm1Tchi> | RIKEN | Strain #RBRC02759; RRID: IMSR_RBRC02759 |
| Mouse: TFEBFlox | Sun et al.4 | N/A |
| Mouse: Foxo3Flox: STOCK Foxo3tm1Rdp/J | The Jackson Laboratory | Strain #024668; RRID: IMSR_JAX:024668 |
| Mouse: CNP-Cre | Lappe-Siefke et al.40 | N/A |
| Mouse: Olig2-Cre: B6.129-Olig2tm1.1(cre)Wdr/J | The Jackson Laboratory | Stock #025567; RRID: IMSR_JAX:025567 |
| Mouse: PDGFRα-CreERT2: B6N.Cg-Tg (Pdgfra-cre/ERT)467Dbe/J | The Jackson Laboratory | Stock #018280; RRID: IMSR_JAX:018280 |
| Mouse: PUMA−: C57BL/6-Bbc3tm1Ast/J | The Jackson Laboratory | Stock #011067; RRID: IMSR_JAX:011067 |
|
| ||
| Oligonucleotides | ||
|
| ||
| MBP in situ probes | ACDbio | Cat#451491 and Cat#451491-C2 |
| PDGFRα in situ probes | ACDbio | Cat#480661 and Cat#480661-C2 |
| MOG in situ probes | ACDbio | Cat#492981-C2 |
| ENPP6 in situ probes | ACDbio | Cat#511021-C2 |
| Pcdh17it in situ probes | ACDbio | Cat#526741-C3 |
|
TFEB qPCR Forward: CCACCCCAGCCATCAACAC Reverse: CAGACAGATACTCCCGAACCTT |
This paper | N/A |
|
Bbc3 (PUMA) qPCR Forward: ACCTCAACGCGCAGTACG Reverse: CACCTAGTTGGGCTCCATTT |
This paper | N/A |
|
Pmaip1(NOXA) qPCR Forward: GCAGAGCTACCACCTGAGTTC Reverse: CTTTTGCGACTTCCCAGGCA |
This paper | N/A |
|
GAPDH qPCR Forward: AGGTCGGTGTGAACGGATTTG, Reverse: TGTAGACCATGTAGTTGAGGTCA |
This paper | N/A |
|
| ||
| Software and algorithms | ||
|
| ||
| Fiji (ImageJ) | National Institutes of Health | RRID: SCR_002285 |
| Incucyte ZOOM System | Sartorius | N/A |
| Bio-Rad ChemiDoc MP Imaging System | Bio-Rad | RRID:SCR_019037 |
| DESeq2 v 1.20.0 | Love et al.41 | RRID: SCR_015687 |
| Proteome Discoverer v2.4 | Thermo Fisher Scientific | RRID: SCR_014477 |
| TBtools | Chen et al.27 | RRID: SCR_023018 |
| Gorilla | Eden et al.42 | RRID: SCR_006848 |
| GraphPad Prism 9 | GraphPad | RRID: SCR_002798 |