KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
|
| ||
| Rabbit polyclonal anti-RH | 35 | N/A |
| Rabbit polyclonal pan Cp | 35 | N/A |
| Mouse monoclonal 1A5 | 35 | N/A |
| Mouse monoclonal 1E12 | 35 | N/A |
| Alexa Fluor 488 goat anti-rabbit IgG (H + L) | Thermo Fisher Scientific | Cat#A11034; RRID: AB_2576217 |
| Alexa Fluor 488 goat anti-mouse IgG (H + L) | Thermo Fisher Scientific | Cat#A11029; RRID: AB_2534088 |
| Alexa Fluor 568 goat anti-mouse IgG (H + L) | Thermo Fisher Scientific | Cat#A11004; RRID: AB_2534072 |
| Alexa Fluor 594 goat anti-rabbit IgG (H + L) | Thermo Fisher Scientific | Cat#A11037; RRID: AB_2534095 |
| Alexa Fluor 647 goat anti-rabbit IgG (H + L) | Thermo Fisher Scientific | Cat#A21245; RRID: AB_2535813 |
|
| ||
| Bacterial and virus strains | ||
|
| ||
| Bacteroides thetaiotaomicron: VPI-5482 strain | Laboratory of Vanessa Sperandio | N/A |
| Bacteroides thetaiotaomicron: VPI-5482 strain; ΔtnaA | Laboratory of Vanessa Sperandio | N/A |
|
| ||
| Chemicals, peptides, and recombinant proteins | ||
|
| ||
| Metabolites and indole analogs, see Table S4 | Sigma-Aldrich; AA Blocks, Inc. | N/A |
| Sodium taurocholate hydrate | Sigma-Aldrich | Cat#86339; CAS: 345,909–26-4 |
| Y-27632 dihydrochloride ROCK inhibitor | Tocris Biosciences | Cat#1254; CAS: 129,830–38-2 |
| VAF347 | Sigma-Aldrich | Cat#182690 |
| FICZ | AA Blocks, Inc. | Cat#AA007VKI; CAS: 172,922–91-7 |
| Kynurenic acid | Sigma-Aldrich | Cat#K3375; CAS: 492–27-3 |
| L-tryptophan | Sigma-Aldrich | Cat#T8941; Cas: 73–22-3 |
| L-phenylalanine | Sigma-Aldrich | Cat#P5482; Cas: 63–91-2 |
| Ampicillin | Sigma-Aldrich | Cat#A0166; Cas: 69–52-3 |
| Neomycin | Sigma-Aldrich | Cat#N1876; Cas: 1405–10-3 |
| Vancomycin | Sigma-Aldrich | Cat#V2002; Cas: 1404–93-9 |
| Puromycin | Sigma-Aldrich | Cat#P8833; Cas: 58–58-2 |
| Formaldehyde | Polysciences | Cat#04018; Cas: 50–00-0 |
| 2-mercaptoethanol | Sigma-Aldrich | Cat#M6250 |
| Triton X-100 | Thermo Fisher Scientific | Cat#BP151–100 |
| Lipofectamine 3000 Transfection Reagent |
Thermo Fisher Scientific | Cat#L3000001 |
| Hoechst 33,342 | Thermo Fisher Scientific | Cat#H3570 |
| ProLong Glass Antifade Mountant | Thermo Fisher Scientific | Cat#P36984 |
| Rotenone | Sigma-Aldrich | Cat#R8875; Cas: 83–79-4 |
| Antimycin A | Sigma-Aldrich | Cat#A8674; Cas: 1397–94-0 |
| Oligomycin | Sigma-Aldrich | Cat#O4876; Cas: 1404–19-9 |
| Carbonyl cyanide m-chlorophenylhydrazone (CCCP) | Sigma-Aldrich | Cat#C2759; Cas: 555–60-2 |
|
| ||
| Critical commercial assays | ||
|
| ||
| Click-iT Plus EdU Alexa Fluor 488 Imaging kit | Thermo Fisher Scientific | Cat#C10637 |
| QIAamp DNA Mini kit | QIAGEN | Cat#51306 |
| QIAamp Powerfecal Pro DNA kit | QIAGEN | Cat#51804 |
| RNeasy Mini kit | QIAGEN | Cat#74104 |
| CellTiter-Glo Luminescent Cell Viability Assay | Promega | Cat#G7571 |
| RQ1 RNase-free DNase | Promega | Cat#M6101 |
| DNA-free DNA removal kit | Thermo Fisher Scientific | Cat#AM1906 |
| SuperScript VILO cDNA synthesis kit | Thermo Fisher Scientific | Cat#11754050 |
| TB Green Advantage qPCR premix | Takara Bio | Cat#639676 |
| Platinum Taq DNA Polymerase, High Fidelity | Thermo Fisher Scientific | Cat#11304011 |
| Seahorse XF Cell Energy Phenotype Test kit | Agilent | Cat#103325–100 |
| Seahorse XF Real-time ATP Rate Assay kit | Agilent | Cat#103592–100 |
| Seahorse XF Cell Mito Stress Test kit | Agilent | Cat#103015–100 |
| MitoTracker® Red CMXRos | Thermo Fisher Scientific | Cat# M7512 |
|
| ||
| Deposited data | ||
|
| ||
| Raw and analyzed RNA-seq data | This paper | GEO: GSE185652 |
| 16S rRNA reads | This paper | ENA: PRJEB58007 |
|
| ||
| Experimental models: Cell lines | ||
|
| ||
| Mouse: NIH/3T3 | ATCC | CRL-1658 |
| Mouse: Ileal epithelial stem cells from C57BL/6 | Laboratory of Thaddeus Stappenbeck |
N/A |
| Human: Lenti-X 293T | Takara Bio | Cat#632180 |
| Human: HCT-8 | ATCC | CCL-244 |
| Human: HCT-8 AhR KO | This paper | N/A |
|
| ||
| Experimental models: Organisms/strains | ||
|
| ||
| Cryptosporidium parvum AUCP-1 isolate | Laboratory of William Witola | N/A |
| Mouse: Infg KO (C57BL/6 background) | Jackson Laboratories | Cat#002287; RRID: IMSR_JAX:002,287 |
|
| ||
| Oligonucleotides | ||
|
| ||
| Primer: human CYP1A1 forward: ACATGCTGACCCTGGGAAAG |
PrimerBank | https://pga.mgh.harvard.edu/primerbank;PrimerBankID:189339226c2 |
| Primer: human CYP1A1 reverse: GGTGTGGAGCCAATTCGGAT |
PrimerBank | https://pga.mgh.harvard.edu/primerbank;PrimerBankID:189339226c2 |
| Primer: human AHRR forward: CTTAATGGCTTTGCTCTGGTCG |
61 | N/A |
| Primer: human AHRR reverse: TGCATTACATCCGTCTGATGGA |
61 | N/A |
| Primer: human GAPDH forward: TGAGTACGTCGTGGAGTCCA |
This paper | N/A |
| Primer: human GAPDH reverse: AGAGGGGGCAGAGATGATGA |
This paper | N/A |
| sgRNA for human AhR exon 1: TCACCTACGCCAGTCGCAAG | This paper | N/A |
| Primer: human AhR forward: GCACCATGAACAGCAGCAG |
This paper | N/A |
| Primer: human AhR reverse: TCCAAGTCCTCTGTCTCCCA |
This paper | N/A |
| Primer: C. parvum GAPDH forward: CGGATGGCCATACCTGTGAG |
34 | N/A |
| Primer: C. parvum GAPDH reverse: GAAGATGCGCTGGGAACAAC |
34 | N/A |
| Primer: mouse GAPDH forward: GCCATGAGTGGACCCTTCTT |
34 | N/A |
| Primer: mouse GAPDH reverse: GAAAACACGGGGGCAATGAG |
34 | N/A |
| Primer: V4 16S rRNA 515 forward: GTGCCAGCMGCCGCGGTAA |
71 | N/A |
| Primer: V4 16S rRNA 805 reverse: GACTACCAGGGTATCTAATCC |
71 | N/A |
|
| ||
| Recombinant DNA | ||
|
| ||
| Plasmid: lentiCRISPR v2 | 63 | Addgene Plasmid #52961 |
| Plasmid: lentiCRISPRv2-sgAhR | This paper | N/A |
| Plasmid: pMD2.g | Laboratory of Didier Trono | Addgene Plasmid #12259 |
| Plasmid: pMDLg/pRRE | 64 | Addgene Plasmid #12251 |
| Plasmid: pRSV-Rev | 64 | Addgene Plasmid #12253 |
|
| ||
| Software and algorithms | ||
|
| ||
| BioTek Gen5 v.3.02 | Agilent | https://www.agilent.com/en/product/cell-analysis/cell-imaging-microscopy/cell-imaging-microscopy-software/biotek-gen5-software-for-imagingmicroscopy-1623226 |
| GraphPad Prism 9 | GraphPad Software | https://www.graphpad.com/ |
| QuantStudio Design & Analysis Software | Thermo Fisher Scientific | https://www.thermofisher.com/us/en/home/global/forms/life-science/quantstudio-3–5-software.html |
| FIJI (ImageJ) | 65 | https://fiji.sc/ |
| Partek Flow | Partek, Inc. | https://www.partek.com/partek-flow/ |
| Enrichr | 70 | http://maayanlab.cloud/Enrichr/ |
| Wave v2.6.1 | Agilent | https://www.agilent.com/en/product/cell-analysis/real-time-cell-metabolicanalysis/xf-software/seahorse-wavedesktop-software-740897 |
| R package: dada2 | 72 | https://benjjneb.github.io/dada2/ |
| R package: phyloseq | 74 | https://www.bioconductor.org/packages/release/bioc/html/phyloseq.html |
|
| ||
| Other | ||
|
| ||
| BioTek Cytation 3 cell imaging multimode reader | Agilent | https://www.biotek.com/products/detection-multi-mode-microplatereaders/cytation-hybrid-multimode-reader/ |
| Axioskop Mot Plus fluorescence microscope | Zeiss | N/A |
| QuantStudio 3 real-time PCR system | Applied Biosciences | Cat#A28137 |
| NovaSeq 6000 sequencing system | Illumina | https://www.illumina.com/systems/sequencing-platforms/novaseq.html |
| Seahorse XF96 Analyzer | Agilent | https://www.agilent.com/en/product/cell-analysis/real-time-cell-metabolicanalysis/xf-analyzers |