Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Base editing frequency by LrCas9-based CBE and ABE in rice T0 lines
| Reagent | Target gene | Site | protospacer + PAM | Tested T0 lines | Mutated T0 lines (number; ratio) | Base editing T0 lines (number; ratio) |
|---|---|---|---|---|---|---|
| CBE | OsDEP1 | Os-CG01 | TCCCGAGCGCGGAGTACGTACGAAA | 21 | 19; 90.5% | 8; 38.0% |
| OsPDS | Os-TG02 | TGGCATTTCTACCTTATCGATGAAA | 21 | 12; 57.1% | 4; 19.1% | |
| ABE V1.0 | OsDEP1 | Os-CG01 | TCCCGAGCGCGGAGTACGTACGAAA | 23 | 0; 0.0% | 0; 0.0% |
| ABE V2.0 | 14 | 2; 14.3% | 2; 14.3% |
