KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
|
| ||
| Rabbit monoclonal anti-PKM1 | Cell signaling | Cat #7067; RRID: AB_2715534 |
| Rabbit monoclonal anti-PKM2 | Novus | Cat# NBP1–48308; RRID: AB_10011057 |
| Chicken monoclonal anti-MAP2 | Abcam | Cat# ab5392; RRID: AB_2138153 |
| Mouse monoclonal anti-NeuN | Millipore | Cat# MAB377; RRID: AB_2298772 |
| Rabbit monoclonal anti-NeuN | Abcam | Cat# ab177487; RRID: AB_2532109 |
| Rabbit anti-BCS1L | Novus | Cat# NBP2–92916 |
| Rabbit anti-Mitf | Abcam | Cat# ab122982; RRID: AB_10902226 |
| Anti-rabbit IgG Alexa Fluor 488 | Thermo Fisher Scientific | A11034; RRID: AB_2576217 |
| Anti-mouse IgG Alexa Fluor 594 | Thermo Fisher Scientific | A-11037; RRID: AB_2534095 |
| Anti-chicken IgG Alexa Fluor 350 | Thermo Fisher Scientific | PI62272 |
| Hoechst | Invitrogen | H1399 |
| Bacterial and virus strains | ||
|
| ||
| Lentivirus (2ND gen) PKM sgRNA | UCSF Viracore | This study |
| Lentivirus (2ND gen) GLUT3 sgRNA | UCSF Viracore | This study |
| Lentivirus (2ND gen) NTG sgRNA | UCSF Viracore | This study |
|
| ||
| Chemicals, peptides, and recombinant proteins | ||
|
| ||
| Paraformaldehyde | Electron Microscopy Science | Cat# 30525–89-4 |
| HEPES | Sigma Aldrich | Cat #3375 |
| D-Glucose | Sigma Aldrich | Cat# G7021 |
| Sodium Pyruvate | Sigma Aldrich | Cat# P2262 |
| Cytochalasin B | Sigma Aldrich | Cat# C2743 |
| 2-Deoxy-D-glucose | Sigma Aldrich | Cat# D8375 |
| Rotenone | Sigma Aldrich | r8875–1g |
| Iodoacetic Acid | Thermo Fisher Scientific | Cat# 35603 |
| Sucrose | Sigma Aldrich | Cat# 9378 |
| Phosphate buffered saline | UCSF Media Production | CCFAL001 |
| Isopentane | Sigma Aldrich | Cat# PHR1661 |
| Triton X-100 | Sigma Aldrich | Cat# T8787 |
| Vectashield antifade mounting medium | Vector Laboratories | Cat# H-1000–10 |
| Prolong gold antifade mountant | Thermo Fisher Scientific | Cat# P36941 |
| Prolong diamond antifade mountant | Thermo Fisher Scientific | Cat# P36970 |
| Goat serum | Thermo Fisher Scientific | Cat# 16210064 |
| MEM Eagle’s with Earle’s BSS Medium | UCSF Cell Culture Facility | CCFAC001 |
| Fetal bovine serum | Hyclone | SH3007103 |
| Glutamax | Gibco | Cat# 175007 |
| Serum extender | Thermo Fisher Scientific | 355006 |
| Uridine | Sigma Aldrich | Cat# U3750 |
| 5-fluoro-2-deoxycytidine | Sigma Aldrich | Cat# F0503 |
| [U-13C]glucose | Cambridge Isotope Labs | CLM-1396–1 |
| [U-13C]Galactose | Sigma Aldrich | Cat# 605379 |
| Neurobasal A media | Gibco | A2477501 |
| NEAA | Gibco | 11140050 |
| N2 supplement | Gibco | 17502048 |
| B27 supplement | Gibco | 17504044 |
| GlutaMAX | Gibco | 35050061 |
| NT-3 | Stemcell Tech | 78074 |
| BDNF | Stemcell Tech | 78005 |
| Laminin | Gibco | 23017015 |
| Ammonium acetate | Sigma Aldrich | Cat# 32301 |
| Methanol | Sigma Aldrich | Cat# 34860 |
| StemFlex medium | ThermoFisher | A3349401 |
| Matrigel | Corning | Cat# 356234 |
| DMEM/F12 | Gibco | Cat#12660012 |
| NEAA | Gibco | Cat#11140050 |
| Doxycycline hyclate | Sigma Aldrich | D9891 |
| ROCK Inhibitor Y27632 | Stemcell Tech | 72302 |
| [U-13C] glucose | Cambridge Isotope Labs | CLM-1396–1 |
| Gadavist | Bayer | 768511 |
| [1-13C]pyruvate | Sigma-Aldrich | 677175 |
| [18F]-fluorodeoxyglucose | University of California San Francisco Radiopharmaceutical Facility | N/A |
|
| ||
| Critical commercial assays | ||
|
| ||
| Glucometer | Ermaine Laboratories | Cat# 37321 |
| Visium spatial gene expression slide & reagent kit | 10X Genomics | 1000184 |
| Dual index Kit TT Set A | 10X Genomics | 1000215 |
| Lonza electroporation Kit | Amaxa | Cat# VVSI-1001 |
| Optimal Cutting Temperature | Tissue-Tek | Cat# 62550–12 |
|
| ||
| Experimental models: Cell lines | ||
|
| ||
| Mouse primary neuronal culture | N/A | This study |
| Human: WTC-11 + NGN2 + dCAS9-KRAB | Martin Kampmann UCSF. | Tian et al.22 |
|
| ||
| Experimental models: Organisms/strains | ||
|
| ||
| GLUT3lox/lox | Jeff Rathmell, Vanderbilt | Contat et al.24 |
| PKM1lox/lox | Mathew Vander Heiden, MIT | Davidson et al.47 |
| CamKIIα | Jackson Laboratories | 005359 |
|
| ||
| Oligonucleotides | ||
|
| ||
| PKM sgRNA GCCGCAGCGGGATAACCTT | IDT | Horlbeck et al.88 |
| GLUT3 sgRNA GGTAAGACTTTGGATCCTTCCTG | IDT | Horlbeck et al.88 |
| NTG sgRNA GCTGCATGGGGCGCGAATCA | IDT | Semple et al.35 Horlbeck et al.88 |
|
| ||
| Recombinant DNA | ||
|
| ||
| iGlucoSnFR-mRuby | Jonathan Marvin, HHMI | N/A |
| ATP fluorescence resonance energy sensor | N/A | Mendelsohn et al.56 |
|
| ||
| Software and algorithms | ||
|
| ||
| Prism 8.4.3 | GraphPad Software | https://www.graphpad.com/scientific-software/prism/ |
| MetaMorph 7.7.3.0 | Universal Imaging | RRID: SciRes_000136 |
| SIVIC software | N/A | http://sourceforge.net/apps/trac/sivic/ |
| MATLAB R2011b | The MathWorks Inc | N/A |
| AMIRA software | Mercury Computer | N/A |
| ImageJ | NIH | http://imagej.nih.gov.ij |
| VivoQuant 4.0 software | Invicro | N/A |
| Dynamic Susceptibility Contrast MR Analysis | DSCoMAN | version 1.0 |
| ANTS | N/A | https://github.com/ANTsX/ANTs |
| pClamp10 software | Molecular Devices | N/A |
| IgorPro6 software | Wavemetrics Inc | N/A |
| 10X Space Ranger software | 10X Genomics | https://support.10xgenomics.com/spatial-gene-expression/software/downloads/latest |
| 10X Loupe Browser software | 10X Genomics | https://www.10xgenomics.com/products/loupe-browser/downloads |
| Enrichr webtool | Avi Ma’ayan Lab | Chen et al.89 Kuleshov et al.90 Xie et al.91 |
|
| ||
| Other | ||
|
| ||
| LSM 880 Confocal Laser Scanning Microscope with Airyscan | Zeiss | N/A |
| SM2000 R microtome | Leica | N/A |
| Labconco CentriVap Concentrator | Labconco | N/A |
| Video tracking | Tracker | N/A |
| 14.1 T vertical MR system | Agilent Technologies | N/A |
| Hypersense DNP polarizer | Oxford Instruments | N/A |
| PET/computerize tomography (CT) scanner | Siemens Healthcare | Inveon |
| COBRA Feldkamp reconstruction algorithm | Exxim Computing Corporation | N/A |
| VT1200 Vibratome | Leica | N/A |
| BSK5 vapor interface holding chamber | Scientific Systems Design Inc. Canada | N/A |
| RC-27LD submerged chamber | Warner Instruments | N/A |
| fDS2A-MKII voltage isolated stimulator | Digitimer North America | N/A |
| Ti-E inverted microscope | Nikon | N/A |
| iXon EMCCD camera | Andor Technology | N/A |
| VC-8 Perfusion valve system | Warner Instruments | N/A |
| A385 Current isolator | World Precision Instruments | N/A |
| SYS-A310 Accupulser signal generator | World Precision Instruments | N/A |
| Aperio Versa slide scanner | Leica | N/A |