KEY RESOURCES TABLE.
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
|
| ||
| Antibodies | ||
|
| ||
| Mouse anti-SMI-32/Neurofilament H (1:1000) | Biolegend | Cat#801701; RRID:AB_2564642 |
| Goat anti-Human Islet-1/ISL1 (1:250) | R&D Systems | Cat#AF1837; RRID:AB_2126324 |
| Mouse anti-NKX6.1 (1:1000) | DSHB | Cat#F55A10-s; RRID:AB_532378 |
| Goat anti-NKX6.1 | R&D Systems | Cat#AF5857; RRID:AB_1857045 |
| Rabbit anti-TUBB3/Tubulin Beta-III (1:1000) | Abnova | Cat#PAB7874; RRID:AB_1716633 |
| Rabbit anti-Nestin/NES (1:1000) | Sigma-Aldrich | Cat#ABD69; RRID:AB_2744681 |
| Mouse anti-S100B (1:250) | Sigma-Aldrich | Cat#S2532; RRID:AB_477499 |
| Donkey anti-Rabbit IgG Alexa Fluor™ 488 (1:1000) |
ThermoFisher Scientific | Cat#A-21206; RRID:AB_2535792 |
| Donkey anti-Mouse IgG Alexa Fluor™ 568 (1:1000) | ThermoFisher Scientific | Cat#A-10037; RRID:AB_2534013 |
| Donkey anti-Rabbit IgG Alexa Fluor™ 647 (1:1000) | ThermoFisher Scientific | Cat#A-31573; RRID:AB_2536183 |
| Donkey anti-Goat IgG Alexa Fluor™ 647 (1:1000) |
ThermoFisher Scientific | Cat#A-21447; RRID:AB_2535864 |
| DAPI (4’,6-Diamidino-2-Phenylindole, Dilactate) (0.1 ug/mL) | ThermoFisher Scientific | Cat#D3571, RRID:AB_2307445 |
|
| ||
| Chemicals, peptides, and recombinant proteins | ||
|
| ||
| X-VIVO 10 Serum-free Hematopoietic Cell Medium | Lonza | Cat#04–380Q |
| MEMα | ThermoFisher Scientific | Cat#12561056 |
| Primate ES Cell Medium | Reprocell | Cat#RCHEMD001 |
| mTeSR1 media | StemCell Technologies | Cat#85850 |
| IMDM | ThermoFisher Scientific | Cat#12440061 |
| Ham’s F-12 Nutrient Mix | ThermoFisher Scientific | Cat#11765062 |
| MEM Non-Essential Amino Acids Solution (100X) |
ThermoFisher Scientific | Cat#11140050 |
| B-27™ Supplement (50X), serum free | ThermoFisher Scientific | Cat#17504044 |
| N-2 Supplement (100X) | ThermoFisher Scientific | Cat#17502048 |
| Pen-Strep-Antimycotic (PSA) | ThermoFisher Scientific | Cat#15240062 |
| LDN193189 | Cayman Chemicals | Cat#17502048 |
| SB431542 | Cayman Chemicals | Cat#13031 |
| CHIR99021 | Xcess Biosciences | Cat#M60002 |
| All-Trans Retinoic Acid (ATRA) | Stemgent | CAT#04–0021 |
| Smoothened agonist (SAG) | Cayman Chemicals | Cat#11914 |
| Y-27632 (ROCKi) | StemCell Technologies | Cat#72308 |
| Compound E | Sigma-Aldrich | Cat#565790 |
| DAPT | Cayman Chemicals | Cat#13197 |
| Dibutyryl-cAMP (dbcAMP) | Sigma-Aldrich | Cat#28745 |
| L-Ascorbic acid | Sigma-Aldrich | Cat#A4403 |
| BDNF | PeproTech | Cat#450–02 |
| GDNF | PeproTech | Cat#450–10 |
| Human IL-2 Recombinant Protein | ThermoFisher Scientific | Cat#PHC0026 |
| Human Recombinant IL-3 | StemCell Technologies | Cat#78040.1 |
| Human Recombinant IL-6 | StemCell Technologies | Cat#78050.1 |
| Human Recombinant G-CSF | StemCell Technologies | Cat#78012.1 |
| Human Recombinant GM-CSF | StemCell Technologies | Cat#78015.1 |
| Dynabeads Human T-Activator CD3/CD28 | ThermoFisher Scientific | Cat#11161D |
| Accutase | Sigma-Aldrich | Cat#SCR005 |
| Fetal Bovine Serum (FBS), qualified | ThermoFisher Scientific | Cat#10437028 |
| Matrigel® Growth Factor Reduced (GFR) | Corning | Cat#354230 |
|
| ||
| Critical commercial assays | ||
|
| ||
| TaqMan™ hPSC Scorecard™ Panel, 384-well |
Thermo Fisher Scientific | Cat#A15870 |
| IdentiClone® TCRB + TCRG T Cell Clonality Assay - Gel Detection |
Invivoscribe | Cat#92000010 |
| Amaxa Human T cell Nucleofector® Kit | Lonza | Cat#VVPA-1002 |
| MycoAlert® Mycoplasma Detection Kit | Lonza | Cat#LT07–118 |
|
| ||
| Deposited data | ||
|
| ||
| RNA sequencing data, WGS data, and patient clinical information | Answer ALS Consortium | dataportal.answerals.org |
|
| ||
| Oligonucleotides | ||
|
| ||
| Epstein-Barr virus nuclear antigen (EBNA), forward primer | Integrated DNA Technologies | GGTCCCGAGAATCCCCATCC |
| Epstein-Barr virus nuclear antigen (EBNA), reverse primer | Integrated DNA Technologies | TTCATGGTCGCTGTCAGACAG |
| GAPDH, forward primer | Integrated DNA Technologies | GTGGACCTGACCTGCCGTCT |
| GAPDH, reverse primer | Integrated DNA Technologies | GGAGGAGTGGGTGTCGCTGT |
|
| ||
| Recombinant DNA | ||
|
| ||
| pEP4 E02S ET2K | Yu et al.46 | RRID:Addgene_20927 |
| pCXLE-hOCT3/4-shp53-F | Okita et al.47 | RRID:Addgene_27077 |
| pCXLE-hUL | Okita et al.47 | RRID:Addgene_27080 |
| pCXLE-hSK | Okita et al.47 | RRID:Addgene_27078 |
| pCXWB-EBNA1 | Okita et al.48 | RRID:Addgene_37624 |
|
| ||
| Software and algorithms | ||
|
| ||
| R Project for Statistical Computing | CRAN | RRID:SCR_001905 |
| tidyverse | CRAN | RRID:SCR_019186 |
| ROCR: Classifier Visualization in R | CRAN | RRID:SCR_008551 |
| DESeq2 | Bioconductor | RRID:SCR_015687 |
| edgeR | Bioconductor | RRID:SCR_012802 |
| biomaRt | Bioconductor | RRID:SCR_019214 |
| variancePartition | Bioconductor | RRID:SCR_019204 |
| karyoploteR | Bioconductor | RRID:SCR_021824 |
| PCAtools | Bioconductor | N/A |
| Hisat2 | Github | RRID:SCR_015530 |
| STAR aligner | Github | RRID:SCR_004463 |
| LeafCutter | Github | RRID:SCR_017639 |
| Samtools | htslib.org | RRID:SCR_002105 |
| DAVID Bioinformatics Resource | david.ncifcrf.gov | RRID:SCR_001881 |