Skip to main content
[Preprint]. 2023 Sep 27:2023.09.26.559432. [Version 1] doi: 10.1101/2023.09.26.559432

Key resources table.

Reagent or resource Designation Source or reference Identifiers Additional information
Cell line (human) HeLa cell line with inducible Cas9 (cTT20.11) Gift from Kara L. McKinley and Iain Cheeseman (McKinley and Cheeseman, 2017) N/A Parent cell line used for NPM1-tagged reporter cells
Cell line (human) Lenti-X HEK 293T cells Takara Biosciences Cat# 632180 For lentivirus production.
Cell line (human) NPM1-mNeonGreen HeLa This paper N/A Tagged at endogenous locus.
Cell line (human) NPM1-mScarlet HeLa This paper N/A Tagged at endogenous locus.
Cell line (human) NPM1WT-mScarlet HeLa This paper N/A
Cell line (human) NPM1mA2-mScarlet HeLa This paper N/A
Cell line (human) NPM1mB1-mScarlet HeLa This paper N/A
Cell line (human) NPM1mA3-mScarlet HeLa This paper N/A
Cell line (human) NPM1mB2-mScarlet HeLa This paper N/A
Construct/Plasmid GFP-NPM WT Gift from Xin Wang, (Wang. W et al., 2005) Addgene # 17578 Used to obtain sequence of NPM1-WT.
Construct/Plasmid pX330 Gift from Feng Zhang Addgene # 42230
Construct/Plasmid pKLM73 Gift from Kara L. McKinley Donor plasmid with C-terminal mNeonGreen and puromycin resistance cassette
Construct/Plasmid pKLM110 Gift from Kara L. McKinley Donor plasmid with C-terminal mScarlet and puromycin resistance cassette
Construct/Plasmid pKLM79 Gift from Kara L. McKinley Lentivirus transfer plasmid with C-terminal mScarlet Fusion tag. SFFV promoter. Used for NPM1 mutant constructs.
Construct/Plasmid NPM1-mNeonGreen-PuroR donor plasmid This paper
Construct/Plasmid NPM1-mScarlet-PuroR donor plasmid This paper
Construct/Plasmid pX330-NPM1 sgRNA This paper Targeting sequence: GCCAGAGATCTTGAATAGCC
Construct/Plasmid SFFV-NPM1WT-mScarlet This paper
Construct/Plasmid SFFV-NPM1mA2-mScarlet This paper
Construct/Plasmid SFFV-NPM1mB1-mScarlet This paper
Construct/Plasmid SFFV-NPM1mA3-mScarlet This paper
Construct/Plasmid SFFV-NPM1mB2-mScarlet This paper
Software μManager Edelstein et al., 2014 Latest nightly build https://micro-manager.org/
Software Pycromanager Pinkard, H. et al., 2021 https://github.com/micro-manager/pycro-manager/
Software R R Core Team, 2021 v. 4.1.1 https://www.r-project.org/
Software Prism GraphPad v. 8.3.0
Software FIJI Schindelin et al., 2012 https://imagej.net/software/fiji/
Software CellProfiler Stirling, D. R. et al., 2021 v.4.0.7 https://cellprofiler.org/
Oligonucleotide 5’ETS RNA FISH probe Integrated DNA Technologies Cy3-CGGAGGCCCAACCTCTCCGACGACAGGTCGCCAGAGGACAGCGTGTCAGC
Oligonucleotide ITS1 RNA FISH probe Integrated DNA Technologies Cy3-CCTCGCCCTCCGGGCTCCGGGCTCCGTTAATGATC
Oligonucleotide ITS2 RNA FISH probe Integrated DNA Technologies Cy3-CTGCGAGGGAACCCCCAGCCGCGCA
Oligonucleotide SKIV2L2 ON-TARGETplus siRNA SMARTPool Horizon Discovery Cat # L-031902-02-0005
Oligonucleotide UPF1 ON-TARGETplus siRNA SMARTPool Horizon Discovery Cat # L-011763-00-0005
Oligonucleotide DDX54 ON-TARGETplus siRNA SMARTPool Horizon Discovery Cat # L-017128-01-0005
Oligonucleotide eIF4A3 ON-TARGETplus siRNA SMARTPool Horizon Discovery Cat # L-020762-00-0005
Oligonucleotide NSA2 ON-TARGETplus siRNA SMARTPool Horizon Discovery Cat # L-017043-01-0005
Oligonucleotide MDN1 ON-TARGETplus siRNA SMARTPool Horizon Discovery Cat # L-009786-00-0005
Oligonucleotide RPF2 ON-TARGETplus siRNA SMARTPool Horizon Discovery Cat # L-024715-01-0005
Oligonucleotide GNL2 ON-TARGETplus siRNA SMARTPool Horizon Discovery Cat # L-020392-01-0005
Oligonucleotide PHF5A ON-TARGETplus siRNA SMARTPool Horizon Discovery Cat # L-014987-01-0005
Oligonucleotide CNOT1 ON-TARGETplus siRNA SMARTPool Horizon Discovery Cat # L-015369-01-0005
Antibody α-tubulin Monoclonal antibody (DM1A) Invitrogen Cat # 62204
Antibody eIF4A3 polyclonal antibody (Rabbit) Proteintech Cat 3 17504-1-AP
Antibody UPF1 (D15G6) Rabbit mAb Cell Signaling Technology Cat # 12040
Antibody SKIV2L2 polyclonal antibody (Rabbit) Novus Biologicals Cat # NB100-1574
Antibody DDX54 polyclonal antibody (Rabbit) Proteintech Cat # 26894-1-AP
Antibody NOL1 Antibody Novus Biologicals Cat # NBP1-92192
Antibody GNL2 Antibody Novus Biologicals Cat # NBP1-81649
Antibody GLTSCR2 Polyclonal Antibody Proteintech Cat # 27353-1-AP
Antibody Goat anti-Mouse IgG (H+L) Cross-Absorbed Secondary Antibody, Alexa 647 Invitrogen Cat # A-21235
Antibody Goat anti-Rabbit IgG (H+L) Cross-Absorbed Secondary Antibody, Alexa 647 Invitrogen Cat # A-21245
Antibody Anti-mouse IgG, HRP-linked Cell Signaling Technology Cat # 7076S
Antibody Anti-Rabbit IgG (whole molecule)-Peroxidase antibody Millipore Cat # A0545-1ML
Chemical Actinomycin D Sigma Cat # A1410-2MG
Chemical CX-5461 SelleckChem Cat # S2684
Chemical Pladienlolide B Tocris Cat # 6070
Chemical Hoechst 22242 ThermoFisher Cat # H3570
Chemical/Reagent Lipofectamine LTX ThermoFisher Cat # 15338030
Chemical/Reagent Lipofectamine 2000 ThermoFisher Cat # 11668027
Chemical/Reagent Lipofectamine RNAiMAX ThermoFisher Cat # 13778075