| probe | 5′ end fluorescent label | Sequence 5′–3′ | Company |
| TelG | Tamra | TTAGGGTTAGGGTTAGGG | Biosynthesis |
| TelC | Cy5 | CCCTAACCCTAACCCTAA | Panagene |
| LacO | Alexa 488 | GAATTGTGAGCGGATAACAATT | Panagene |
| scramble | Alexa 488 | GGGTAGGAGGTTAGTGTTTTGAGT | Panagene |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.