REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Anti-IGF1R	Cell Signaling	Cat#9750;RRID:AB_10950969
Anti-HexB	Abcam	Cat#ab140649;RRID:AB_3065101
Anti-GAPDH	Millipore Sigma	Cat#MAB374;RRID:AB_2107445
Bacterial and virus strains
E.coli DH5-α	New England Bioscience	Cat# C2987I
Chemicals, peptides, and recombinant proteins
AgeI-HF	New England Biolabs	Cat# R3552S
KpnI-HF	New England Biolabs	Cat# R3142S
CutSmart Buffer	New England Biolabs	Cat# B7204 actually replaced by Cat# B6004S
QIAquick gel extraction kit	QIAGEN	Cat# 28706
In-Fusion Cloning	TakaraBio Ltd	Cat# 638947
Kifunensine	Cayman Chemical	Cat# 109944-15-2
Anthranilic Acid	Sigma-Aldrich	Cat# A89855
MORPHEUS Crystallisation Screen	Molecular Dimensions	Cat# MD1–47
HEPES	Sigma-Aldrich	Cat# H3375
Imidazole	Honeywell Fluka	Cat# 56750
Deposited data
Python code	This paper	https://doi.org/10.5281/zenodo.8305097
CtUGGTGT24	This paper	PDB ID 7ZKC
U2FCtUGGTGT24	This paper	PDB ID 7ZLU
5M−8OH−QCtUGGTGT24	This paper	PDB ID 7ZLL
Experimental models: Cell lines
HEK FreeStyleTM 293F cells	ThermoFisher Scientific	Cat# R79007
HEK293-EBNA1-6E ALG6-/-	Adams et al.48
HEK293-EBNA1-6E ALG6/UGGT1-/-	Adams et al.48
HEK293-EBNA1-6E ALG6/UGGT2-/-	Adams et al.48
HEK293-EBNA1-6E ALG6/UGGT1/2-/-	Adams et al.48
Oligonucleotides
OPPF UGGT1 Fwd gcgtagctgaaaccggc GACTCAAAAGCCATTACAACCTCTCT	Eurofins Scientific	NA
OPPF UGGT1 Rev gtgatggtgatgttt TTTCTGAGGACCTTCTCGGCTTGG	Eurofins Scientific	NA
Recombinant DNA
UGGT1-pUC57	Genscript	NA
pOPINTTGneo:hUGGT1 plasmid	This paper	NA
Software and algorithms
autoPROC	Vonrhein et al.77	Version 1.0.5
Coot	Emsley et al.78	Version 0.9
BUSTER	Blanc et al.79	Version 2.10.3
GLYCAM-web	Singh et al.,80	Version 1.0
AutoDock-Bias	Arcon et al.,81	Version 1.0
AutoDock4	Morris et al.,82	Version 4.0