REAGENT or RESOURCE	SOURCE	IDENTIFIER
Bacterial and virus strains
Lenti-EV-GFP-VSVG	University of Michigan Vector Core	Lenti-EV-GFP-VSVG
Chemicals, peptides, and recombinant proteins
CellAdhere Laminin-521	STEMCELL Technologies	Cat#77003
CloneR2	STEMCELL Technologies	Cat#100-0691
Geltrex LDEV-Free, hESC-Qualified, Reduced growth factor basement membrane matrix	Thermo Fisher Scientific	Cat#A1413302
AccuGENE 0.5 M EDTA Solution	Lonza	Cat#51201
Dulbecco’s phosphate-buffered saline (DPBS) no calcium, no magnesium	Thermo Fisher Scientific	Cat#14190144
Dulbecco’s phosphate-buffered saline (DPBS) calcium, magnesium	Thermo Fisher Scientific	Cat#14040133
Ambion Nuclease Free Water	Invitrogen	Cat#AM9930
Critical commercial assays
Q5 High-Fidelity 2× Master Mix	New England Biolabs	Cat#M0492S
QIAquick PCR Purification Kit	QIAGEN	Cat#28104
DNeasy Blood & Tissue Kit	QIAGEN	Cat#69504
Infinium CoreExome-24 v1.4 Kit	Illumina Inc	Cat#20039222
TrueCut Cas9 Protein v2	Invitrogen	Cat#A36498
Mirus Bio TransIT-LT1 Transfection Reagent	Mirus Bio LLC	Cat#MIR2300
Precision gRNA Synthesis Kit	Thermo Fisher Scientific	Cat#A29377
Experimental models: Cell lines
WA01 (H1) Male Embryonic Stem Cells	WiCell	Cat#WA01
WA09 (H9) Female Embryonic Stem Cells	WiCell	Cat#WA09
UM4-6	Haenfler et al.6	N/A
UM139-2	Haenfler et al.6	N/A
CON2E	Tidball et al.5	N/A
SCN1B-4A	This paper	Louis Dang unpublished cell line
SCN1B-6B	This paper	Louis Dang unpublished cell line
Oligonucleotides
POGZ sgRNA sequence 1: TCGCTCCTCACTCTACTCTG	Deng et al.1	N/A
POGZ sgRNA sequence 2: CCTCCTCACATTCCATGAAC	Deng et al.1	N/A
Primer to confirm sgRNA1 editing: POGZ Primer Forward 1: GCCTAGTACCTGGTGCCTCA	Deng et al.1	N/A
Primer to confirm sgRNA1 editing: POGZ Primer Reverse1: GGCCTCTCAGTTGTTCACTTC	Deng et al.1	N/A
Primer to confirm sgRNA2 editing: POGZ Primer Forward 2: TCAGAAGAGCTTTTGTTACCTGTG	Deng et al.1	N/A
Primer to confirm sgRNA2 editing: POGZ Primer Reverse 2: CCAAGGAGGTAGGTTACCAATG	Deng et al.1	N/A
Recombinant DNA
pSpCas9(BB)-2A-Puro V2.0 (PX459)	Ran et al.2	Addgene plasmid #62988
AAVS1-TALEN-L	Gonzalez et al.3	Addgene plasmid #59025
AAVS1-TALEN-R	Gonzalez et al.3	Addgene plasmid #59026
AAVS1-CAG-hrGFP	Qian et al.4	Addgene plasmid #52344
Software and algorithms
ICE CRISPR Analysis Tool	Synthego	https://www.synthego.com/products/bioinformatics/crispr-analysis
Genome Viewer v2.0	Illumina	https://support.illumina.com/array/array_software/genomestudio/downloads.html
Other
Accutase Cell Detachment Solution	Innovative Cell Technologies	Cat#AT104
Dulbecco’s Modified Eagle Medium/ Nutrient Mixture F-12 (DMEM/F-12), HEPES	Thermo Fisher Scientific	Cat#11330032
mTeSR Plus	STEMCELL Technologies	Cat#100-0276
Biological Safety Cabinet model: 1300 series A2	Thermo Fisher Scientific	Cat#1323TS
Horizontal Laminar Flow Cabinet model: HeraGuard ECO	Thermo Fisher Scientific	Cat#51029701
CO2 incubator model: HERAcell vios 160i	Thermo Fisher Scientific	Cat#51033557
Inverted fluorescence cell culture microscope model: CKX53F3	Olympus	Cat#CKX53
EVOS FL Auto Imaging System	Thermo Fisher Scientific	Cat#EVOSFL
Countess 3 Automated Cell counter	Invitrogen	Cat# A49865
The STRIPPER Micropipetter with Free Standing Comfort Grip	Cooper surgical	Cat#MXL3-STR-CGR https://fertility.coopersurgical.com/micropipettes/the-stripper/
Fisherbrand Imetera Diamond Scribes	Fisher Scientific	Cat#08-675 https://www.fishersci.com/shop/products/imetra-diamond-scribes/08675#?keyword=08-675
Borosilicate glass capillary 1 mm × 0.58 cm × 10 cm	Sutter Instrument	Cat#B100-58-10 https://www.sutter.com/MICROPIPETTE/glass.html
Micropipette puller model: P-87	Sutter Instrument	Cat#P-87 https://www.sutter.com/MICROPIPETTE/p-97.html
Microforge Model: MF2	Narishige	Cat#MF2 https://products.narishige-group.com/group1/MF2/pipette/english.html
35 mm Petri dish	Fisher Scientific	Cat#08-757-100A
Falcon Standard Tissue Culture Dishes	Fisher Scientific	Cat#08-772E
96-well cell culture, flat bottom microplate	Fisher Scientific	Cat#08-772-2C
Sterile 15-mL centrifuge tubes	ASI Scientific	Cat#CN50601
1-Channel mechanical pipette	Fisher Scientific	F123600TG, F123602G
Sterile micropipette tips	Fisher Scientific	Cat#02-707-432, 1111-2721