KEY RESOURCES TABLE.
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
|
| ||
| Antibodies | ||
|
| ||
| Goat anti-APOE | Milipore | Cat#178479; RRID:AB_10682965 |
| Rabbit anti-Amyloid Precursor Protein | Sigma-Aldrich | Cat# A8717, RRID:AB_258409 |
| Mouse anti-Phospho-Tau (Ser202, Thr205) | Thermo Fisher Scientific | Cat# MN1020, RRID:AB_223647 |
| Mouse anti-GAPDH | Proteintech | Cat# 60004-1-Ig, RRID:AB_2107436 |
| Chicken anti-GFAP | Abcam | Cat# ab4674, RRID:AB_304558 |
| Goat anti-AIF1 | Abcam | Cat# ab5076, RRID:AB_2224402 |
| Rabbit anti- LC3 | MBL International | Cat# PM036, RRID:AB_2274121 |
| Chicken anti-MAP2 | Abcam | Cat# ab5392, RRID:AB_2138153 |
| Mouse anti-LR11 (SORL1) | BD Biosciences | Cat# 611860, RRID:AB_399340 |
| Rabbit anti-Synapsin 1 | Millipore | Cat# 574777-10UG, RRID:AB_10683065 |
| Rabbit anti-Tau | Agilent | Cat# A0024, RRID:AB_10013724 |
| Mouse anti-ZO-1 | Thermo Fisher Scientific | Cat# MA3-39100-A555, RRID:AB_2663168 |
| Mouse anti-Tubulin, beta III isoform | Millipore | Cat# MAB1637, RRID:AB_2210524 |
| Mouse anti-vimentin | Millipore | Cat# CBL202, RRID:AB_93387 |
| Rabbit anti-clusterin | Abcam | Cat# ab92548, RRID:AB_10585132 |
| APOE | Invitrogen | PA5-18361, RRID:AB_10979861 |
| Mouse anti-SORL1 (Clone 525122) | R and D Systems | Cat# MAB5699, RRID:AB_2239592 |
| Rabbit anti-NeuN | Abcam | Cat# ab190565, RRID:AB_2732785 |
|
| ||
| Bacterial and virus strains | ||
|
| ||
| pTet-O-NGN2-puro | Zhang et al. 201329 | Addgene plasmid #52047 |
| Tet-O-FUW-EGFP | Zhang et al. 201329 | Addgene plasmid #30130 |
| FUdeltaGW-rtTA | Zhang et al. 201329 | Addgene plasmid #19780 |
| Tet-O-SOX9-puro | Canals et al. 201830 | Addgene plasmid #117269 |
| Tet-O-NFIB-hygro | Canals et al. 201830 | Addgene plasmid #117271 |
| APOE shRNA construct1 | Sigma Aldrich | TRCN0000371278 |
| APOE shRNA construct2 | Sigma Aldrich | TRCN0000377711 |
|
| ||
| Biological samples | ||
|
| ||
| Postmortem brain tissues | New York Brain Bank | see Supplemental Tables |
| Human brain samples MPFC | RUSH RADC Brain Bank | http://www.radc.rush.edu/ |
|
| ||
| Chemicals, peptides, and recombinant proteins | ||
|
| ||
| R33 | MedKoo Biosciences | 504211 |
| Trehalose dihydrate | Sigma Aldrich | 625625 |
| Chloroquine | Tocris | 4109 |
| TGF-β | Sigma Aldrich | T7039 |
| SB431542 | Calbiochem | 616464 |
|
| ||
| Critical commercial assays | ||
|
| ||
| LipidSpotTM 610 | Biotium | 70069 |
| V-PLEX Aβ Peptide Panel 1 (6E10) Kit | Meso Scale Discovery | cat. #K15200G-1 |
| R-PLEX Human ApoE Assay | Meso Scale Discovery | cat. #K1512IR-2 |
| R-PLEX Human Clusterin Assay | Meso Scale Discovery | cat. #K151YLR-2 |
|
| ||
| Deposited data | ||
|
| ||
| RNAseq data | This paper | NCBI GEO database, GEO: GSE238013 |
| Lagomarsino et al. 202132 | AMP-AD Knowledge Portal; SynID: syn2580853 and SynID: syn3219045 For quick visualization of SORL1 KO and WT data, please also see https://youngpearselab.shinyapps.io/sorl1_namei_cells/. | |
| Lipidomics data | This paper | Metabolights, study ID: MTBLS8242 |
| Mass spectrometry proteomics data | This paper | ProteomeXchange Consortium via the PRIDE partner repository PRIDE: PXD044093 |
|
| ||
| Experimental models: Cell lines | ||
|
| ||
| Human iPSC line: Wildtype clone A7 (“line #1”, >90% European ancestry) | Knupp et al. 202016 | N/A |
| Human iPSC line: SORL1 Knockout clone E4 (“line #1” >90% European ancestry) | Knupp et al. 202016 | N/A |
| Human iPSC line: SORL1 G511R clone C6 (“line #1”, >90% European ancestry) | Mishra et al. 202245 | N/A |
| Human iPSC line: Wildtype clone 5 (“line #2”, >90% European ancestry) | This paper | N/A |
| Human iPSC line: SORL1 Knockout clone 4 (“line #2”, >90% European ancestry) | This paper | N/A |
| HUMAN IPSC LINE: BR01, 99% European ancestry | Lagomarsino et al. 202132 | BR01, AJ0006 |
| HUMAN IPSC LINE: BR04, 98% European ancestry | Lagomarsino et al. 202132 | BR04, AJ0056 |
| HUMAN IPSC LINE: BR08, 94% European ancestry | Lagomarsino et al. 202132 | BR08, AJ0044 |
| HUMAN IPSC LINE: BR09, 92% European ancestry | Lagomarsino et al. 202132 | BR09, AJ0038 |
| HUMAN IPSC LINE: BR103, 94% European ancestry | Lagomarsino et al. 202132 | BR103, AJ0121 |
| HUMAN IPSC LINE: BR104, 95% European ancestry | Lagomarsino et al. 202132 | BR104, AJ0113 |
| HUMAN IPSC LINE: BR108, 82% European ancestry | Lagomarsino et al. 202132 | BR108, AJ0117 |
| HUMAN IPSC LINE: BR11, 99% European ancestry | Lagomarsino et al. 202132 | BR11, AJ0002 |
| HUMAN IPSC LINE: BR13, 92% European ancestry | Lagomarsino et al. 202132 | BR13, AJ0039 |
| HUMAN IPSC LINE: BR14, 99% European ancestry | Lagomarsino et al. 202132 | BR14, AJ0003 |
| HUMAN IPSC LINE: BR15, 93% European ancestry | Lagomarsino et al. 202132 | BR15, AJ0008 |
| HUMAN IPSC LINE: BR21, 92% European ancestry | Lagomarsino et al. 202132 | BR21, AJ0046 |
| HUMAN IPSC LINE: BR22, 93% European ancestry | Lagomarsino et al. 202132 | BR22, AJ0021 |
| HUMAN IPSC LINE: BR24, 93% European ancestry | Lagomarsino et al. 202132 | BR24, AJ0040 |
| HUMAN IPSC LINE: BR26, 94% European ancestry | Lagomarsino et al. 202132 | BR26, AJ0043 |
| HUMAN IPSC LINE: BR27, 97% European ancestry | Lagomarsino et al. 202132 | BR26, AJ0001 |
| HUMAN IPSC LINE: BR28, 93% European ancestry | Lagomarsino et al. 202132 | BR28, AJ0029 |
| HUMAN IPSC LINE: BR29, 95% European ancestry | Lagomarsino et al. 202132 | BR29, AJ0030 |
| HUMAN IPSC LINE: BR30, 94% European ancestry | Lagomarsino et al. 202132 | BR30, AJ0042 |
| HUMAN IPSC LINE: BR33, 91% European ancestry | Lagomarsino et al. 202132 | BR33, AJ0047 |
| HUMAN IPSC LINE: BR36, 95% European ancestry | Lagomarsino et al. 202132 | BR36, AJ0022 |
| HUMAN IPSC LINE: BR37, 93% European ancestry | Lagomarsino et al. 202132 | BR37, AJ0031 |
| HUMAN IPSC LINE: BR39, 98% European ancestry | Lagomarsino et al. 202132 | BR39, AJ0005 |
| HUMAN IPSC LINE: BR40, 94% European ancestry | Lagomarsino et al. 202132 | BR40, AJ0045 |
| HUMAN IPSC LINE: BR41, 95% European ancestry | Lagomarsino et al. 202132 | BR41, AJ0024 |
| HUMAN IPSC LINE: BR43, 91% European ancestry | Lagomarsino et al. 202132 | BR43, AJ0020 |
| HUMAN IPSC LINE: BR46, 98% European ancestry | Lagomarsino et al. 202132 | BR46, AJ0004 |
| HUMAN IPSC LINE: BR48, 91% European ancestry | Lagomarsino et al. 202132 | BR48, AJ0028 |
| HUMAN IPSC LINE: BR50, 94% European ancestry | Lagomarsino et al. 202132 | BR50, AJ0041 |
| HUMAN IPSC LINE: BR54, 91% European ancestry | Lagomarsino et al. 202132 | BR54, AJ0048 |
| HUMAN IPSC LINE: BR57, 93% European ancestry | Lagomarsino et al. 202132 | BR57, AJ0073 |
| HUMAN IPSC LINE: BR58, 89% European ancestry | Lagomarsino et al. 202132 | BR58, AJ0068 |
| HUMAN IPSC LINE: BR59, 93% European ancestry | Lagomarsino et al. 202132 | BR59, AJ0072 |
| HUMAN IPSC LINE: BR60, 89% European ancestry | Lagomarsino et al. 202132 | BR60, AJ0067 |
| HUMAN IPSC LINE: BR61, 93% European ancestry | Lagomarsino et al. 202132 | BR61, AJ0076 |
| HUMAN IPSC LINE: BR62, 93% European ancestry | Lagomarsino et al. 202132 | BR62, AJ0069 |
| HUMAN IPSC LINE: BR63, 94% European ancestry | Lagomarsino et al. 202132 | BR63, AJ0070 |
| HUMAN IPSC LINE: BR64, 94% European ancestry | Lagomarsino et al. 202132 | BR64, AJ0066 |
| HUMAN IPSC LINE: BR65, 86% European ancestry | Lagomarsino et al. 202132 | BR65, AJ0080 |
| HUMAN IPSC LINE: BR66, 93% European ancestry | Lagomarsino et al. 202132 | BR66, AJ0094 |
| HUMAN IPSC LINE: BR67, 94% European ancestry | Lagomarsino et al. 202132 | BR67, AJ0099 |
| HUMAN IPSC LINE: BR68, 92% European ancestry | Lagomarsino et al. 202132 | BR68, AJ0095 |
| HUMAN IPSC LINE: BR69, 94% European ancestry | Lagomarsino et al. 202132 | BR69, AJ0103 |
| HUMAN IPSC LINE: BR72, 91% European ancestry | Lagomarsino et al. 202132 | BR72, AJ0090 |
| HUMAN IPSC LINE: BR83, 94% European ancestry | Lagomarsino et al. 202132 | BR83, AJ0083 |
| HUMAN IPSC LINE: BR89, 93% European ancestry | Lagomarsino et al. 202132 | BR89, AJ0089 |
| HUMAN IPSC LINE: BR91, 91% European ancestry | Lagomarsino et al. 202132 | BR91, AJ0115 |
| HUMAN IPSC LINE: BR92, 92% European ancestry | Lagomarsino et al. 202132 | BR92, AJ0116 |
| HUMAN IPSC LINE: BR93, 94% European ancestry | Lagomarsino et al. 202132 | BR93, AJ0114 |
| HUMAN IPSC LINE: BR95, 93% European ancestry | Lagomarsino et al. 202132 | BR95, AJ0119 |
| HUMAN IPSC LINE: BR97. 90% European ancestry | Lagomarsino et al. 202132 | BR97, AJ0123 |
| HUMAN IPSC LINE: BR98, 96% European ancestry | Lagomarsino et al. 202132 | BR98, AJ0109 |
| HUMAN IPSC LINE: BR99, 95% European ancestry | Lagomarsino et al. 202132 | BR99, AJ0107 |
| Human iPS Cell Line (Episomal, CD34+, ApoE Knockout) | Alstem cell advancement | iPS36 |
| Human iPS Cell Line (Episomal, CD34+, ApoE3) | Alstem cell advancement | iPS26 |
| Human iPS Cell Line (Episomal, CD34+) | Alstem cell advancement | iPS16 |
|
| ||
| Oligonucleotides | ||
|
| ||
| SORL1 KO line#1 gRNA: ‘ATTGAACGACATG AACCCTC’ | Knupp et al. 202016 | N/A |
| SORL1 KO line#1 ssODN: ‘GGGAATTGATCC CTATGACAAACCAAATACCATCTACATTGAACGACA TGAACCCTCTGGCTACTCCACGTCTTCCGA AG TACAGATTTCTTCCAGTCCCGGGAAAACCAGGAAG’ | Knupp et al. 202016 | N/A |
| SORL1 G511R gRNA: ‘CTCTTGCATTTTAGGCTCAG’ | Mishra et al. 202245 | N/A |
| SORL1 G511R ssODN: ‘CTGACATATTCTTGAAA TTAAAAATAATTATTTCTCTTGCATTTTAGGCTCA GTGCGAAAGAACTTGGCTAGCAAGACAAACGTG TACATCTCTAGCAGTGCTGGAGCCAGGTGGCG’ | Mishra et al. 202245 | N/A |
| SORL1 KO line#2 gRNA: ‘ATGTTCCTGAATCATGATCC’ | This paper | N/A |
|
| ||
| Software and algorithms | ||
|
| ||
| R Studio, v3.6.1 of R; v1.2.5019 of R Studio | R Core Team, 202054 | https://www.rstudio.com |
| Sleuth, v0.30.0 | Pimentel et al., 201740 | https://www.rdocumentation.org/packages/sleuth/versions/0.30.0 |
| Cell Profiler | McQuin et al., 201855 | https://cellprofiler.org/ |
| All original code used in this paper | This paper |
https://github.com/genejockey33000/typGumbo. Zenodo; https://doi.org/10.5281/zenodo.8183364 |