Abstract
Background
Staphylococcus aureus spreads its infections through biofilms. This usually happens in the stationary phase of S. aureus growth where it utilizes accumulated acetate as a carbon source via the phosphotrans-acetylase-acetate kinase (Pta-Ack) pathway. In which acetate kinase (ackA) catalyzes the substrate-level phosphorylation, a vital secondary energy-yielding pathway that promotes biofilms formation aids bacterium survival in hostile environments. In this study, we describe the cloning, sequencing, and expression of S. aureus ackA gene. The expression analysis of ackA gene in methicillin-resistant strains of S. aureus (MRSA) correlates with ackA activity and biofilm units. The uniqueness of ackA was analyzed by using in silico methods.
Results
Elevated ackA gene expression was observed in MRSA strains, which correlates with increased ackA activity and biofilm units, explaining ackA role in MRSA growth and pathogenicity. The pure recombinant acetate kinase showed a molecular weight of 44 kDa, with enzyme activity of 3.35 ± 0.05 μM/ml/min. The presence of ACKA-1, ACKA-2 sites, one ATP, and five serine/threonine-protein kinase sites in the ackA gene (KC954623.1) indicated that acetyl phosphate production is strongly controlled. The comparative structural analysis of S. aureus ackA with ackA structures of Mycobacterium avium (3P4I) and Salmonella typhimurium (3SLC) exhibited variations as indicated by the RMSD values 1.877 Å and 2.141 Å respectively, explaining why ackA functions are differently placed in bacteria, concurring its involvement in S. aureus pathogenesis.
Conclusions
Overall findings of this study highlight the correlation of ackA expression profoundly increases survival capacity through biofilm formation, which is a pathogenic factor in MRSA and plays a pivotal role in infection spreading.
Keywords: Multidrug-resistant Staphylococcus aureus, Acetate kinase, Biofilm, Acetate, MRSA
Introduction
Staphylococcus aureus is a Gram-positive, facultative anaerobe human pathogen that is the leading cause of nosocomial and community-acquired infections [1–3]. This human pathogen can adapt and colonize on both biotic and abiotic surfaces and it can infect several anatomical sites in the human body via adaptive metabolism and biofilm formation [4–6]. The bacterium’s adaptability is based on its ability to detect and utilize nutrients from a variety of sources, as well as respond effectively to rapid environmental conditions. This is accomplished by modulating the expression of genes involved in several metabolic pathways, which effects the expression of virulence factors, and biofilm formation [7, 8].
Biofilms are surface-associated multicellular communities in which bacteria are embedded in a self-produced extracellular polymeric substance (EPS) which is mainly composed of polysaccharides, proteins, lipids, and nucleic acids. Biofilm formation occurs during the stationary phase of growth and is aided by the secretion of many virulence factors, cell wall-associated adherence proteins such as protein A, and fibronectin-binding proteins that are important for colonization, nutrient acquisition, tissue invasion, and dodging of host defenses [9–13].
Ever-increasing rates of staphylococci infections, both community- and hospital-acquired strains, are often rising across the globe [14–16]. However, the acquisition of multidrug resistance and an increased rate of biofilm formation in S. aureus has posed difficulties in the treatment of the infections caused by these strains, particularly, community-associated methicillin-resistant S. aureus (CA-MRSA) that have resulted in the rapid spread of infections across the globe, causing significant morbidity, mortality, and economic loss [17–22]. The rapidity with which this pathogen spreads its infection from one human host to another is through the formation of biofilms, which not only helps the pathogen escape the harsh environment caused by antibiotic treatment but also paves the way for newer infections [23–25], and elevated biofilm formation was noted in MRSA [6, 12, 25–27].
S. aureus catabolizes carbohydrates primarily through the pentose phosphate and glycolytic pathways, generating pyruvate and ATP [8, 28, 29], which are largely dependent on redox status. Under anaerobic growth, pyruvate is reduced to lactic acid, while in aerobic growth, pyruvate undergoes oxidative decarboxylation to generate acetyl-coenzyme A [30–32]. This acetyl-CoA is converted into acetyl phosphate and is used in the substrate-level phosphorylation through the phosphotrans-acetylase-acetate kinase (Pta-AckA) pathway to generate acetate and ATP. An excess amount of acetate excretes into the culture medium until the concentration of glucose decreases to a level at which it can no longer sustain rapid growth. The departure from the exponential phase of growth increases the utilization of acetate in energy generation and biofilm formation [32–37]. In the absence of oxygen, S. aureus does not induce the full tricarboxylic acid (TCA) cycle [8, 29, 33, 34, 38]; thus, ATP must come from substrate phosphorylation of acetate and acetyl phosphate (acP) via the Pta-AckA pathway [33, 39, 40]. Acetate kinase catalyzes the reversible magnesium-dependent phosphorylation of acetate using ATP as a phosphate donor and plays a significant role in regulatory phosphorylation reactions via acetyl phosphate [31, 33, 36, 39, 41]. Previous evidence suggests that catabolism of acetate and acetyl phosphate functions as global signals involved in host–pathogen interactions, and biofilm formation is associated with alterations in the redox status and repression of TCA cycle activity [33, 36, 40–42]. Acetate generation and its utilization in bacteria are uniquely placed and it depends purely on the growth conditions and environment; thus, the acetate kinase structure and functions are also unique to the organism [43–45]. This enzyme’s uniqueness in each organism, particularly in pathogenic bacteria, aids its survival in a variety of clinical settings [5, 43–47]. Since acetate kinase is important in both catabolism and anabolism in S. aureus and the absence of acetate kinase in human beings helps the spread of infections caused by multidrug-resistant strains, these make this enzyme all the more important in view rapid occurrence of MRSA strains [41, 48, 49]. This drug resistance in S. aureus is correlated with elevated acetyl phosphate formation [42]; given the metabolic importance of acetate kinase and its subtle role in the survival and pathogenesis of S. aureus, the present study is aimed to characterize the acetate kinase gene and its expression in multidrug-resistant strains of Staphylococcus aureus with an emphasis on methicillin-resistant strains of S. aureus (MRSA) and its association in the biofilm formation.
Methods
Bacterial strains growth and culture conditions
Staphylococcus aureus ATCC12600 and multidrug-resistant strains of S. aureus (LMV-1, 2, 3, 4, 5, 6 isolated from Local Milk Vendor and D-1, 2, and 4 isolated from Dairy herd) were grown in Baird Parker medium. These strains were also plated in Muller Hilton agar plates with ampicillin, oxacillin, and penicillin. The methicillin-resistant strains of S. aureus LMV 3–5 (MRSA) showed resistance to ampicillin, oxacillin, and penicillin with the conspicuous presence of mec A gene [12, 50, 51]. The cultures were confirmed by Gram staining, coagulase test, and catalase tests. A single isolated colony was inoculated in both Luria–Bertani (LB) and Brain heart infusion (BHI) broths and grown overnight at 37 °C. The grown cultures were used for the isolation of cytosolic fraction, characterization of acetate kinase, isolation of chromosomal DNA, and total RNA.
Acetate kinase (ackA) gene amplification and sequencing
Overnight grown culture of S. aureus ATCC12600 was used for the isolation of genomic DNA [51] and the isolated chromosomal DNA was used for the amplification of ackA (Table 1). The PCR products were electro eluted and the sequence was performed by dye terminating method at commercial service (MWG Biotech India Ltd). The obtained sequence was analyzed and deposited in GenBank (accession number: KC954623.1). For expressing the ackA gene, new primers containing the sites for restriction enzymes Sal I and Hind III were used (Table 1). The PCR products were electrophoresed in 1.2% agarose gel and were electroeluted from the agarose gel [12, 52].
Table 1.
Primers for the amplification of ackA gene from the S. aureus ATCC12600 and used in the present study
| Primers | PCR conditions | PCR product size in Kbp |
|---|---|---|
|
A: For primary sequencing of ackA gene Forward Primer: 5′ATGTCAAAATTAATC 3′ Reverse Primer: 5′TTATTTTAGACCACCG 3′ |
one cycle 5 min at 94 °C, 35 cycles 50 s at 94 °C, 45 s at 36.5 °C 2 min at 72 °C, and a final hold 10 min at 72 °C | 1.2 |
|
B: For cloning and expression of ackA gene Forward Primer: 5′TTACTTGTCGACATGTCAAAATT3′ Reverse Primer: 5′AAAAAAAAGCTTTTATTTTAGACC3′ |
one cycle 5 min at 94 °C, 35 cycles 50 s at 94 °C, 45 s at 36.5 °C 2 min at 72 °C, and a final hold 10 min at 72 °C | 1.2 |
Cloning, expression, and characterization of acetate kinase (ackA) gene
The amplified PCR product was electroeluted from agarose gel and digested with Sal I and Hind III restriction endonucleases. The resultant digested PCR product was ligated with pQE 30 (QIAGEN, Valencia, CA) digested with Sal I and Hind III, and transformed into E. coli DH5α [51, 52]. The positive recombinant clones were identified by PCR and sequencing. The clone PSackA containing the ackA gene was grown in LB medium containing ampicillin (100 μg/ ml) at 37 °C, and expression of the His-6-tagged acetate kinase was induced with 1 mM IPTG. The recombinant protein was purified using a nickel-metal chelate agarose column and was analyzed in 10% SDS-PAGE [12, 51, 52].
Acetate kinase assay
Acetate kinase (ackA) is present in the cytoplasm of bacteria; therefore, cytosolic fraction was isolated from the overnight grown cultures of S. aureus strains [51]. The assay mixture 0.5 ml contained 100 mM Tris-HC1 buffer pH 7.3, 2 mM potassium acetate, 1.5 mM ATP, 2 mM MgC12, 2 mM phosphoenolpyruvate, 0.4 mM NADH, 5 units of pyruvate kinase (PK), and 10 units of lactate dehydrogenase (LDH). Assays were initiated by the addition of either the cytosolic fraction or pure recombinant ackA, the reaction was monitored by taking optical density at 340 nm against blank, i.e., without a cytosolic fraction or pure recombinant ackA, and the enzyme activity was expressed as μM of NADH formed for ml per minute [36, 52, 53].
Real-time PCR
MEDOX-Easy™ Spin column total RNA mini preps kit was used to isolate total RNA from all the strains of S. aureus included in the present study, and cDNA was generated using high capacity cDNA reverse transcription kit (Applied Biosystems). Reverse transcription was performed in a thermocycler standardized at 25 °C for 10 min, 37 °C for 120 min, and 85 °C for 5 min, and thus formed cDNA was used as a template in quantitative real-time PCR (qPCR). The qPCR was executed in ABI 7300 with an SYBR select master mix for 45 cycles. The expression of the ackA gene in different strains of S. aureus was measured using DNA gyrase expression as an endogenous control (Table 2). The expression levels were calculated by using the (2−ΔΔCt) method [12, 54].
Table 2.
Quantitative Real time PCR primers for the studying of ack A gene expression in different strains of S. aureus
| Genes | Primers | qPCR conditions |
|---|---|---|
| DNA gyrase |
Forward Primer CGATTGCTCTAGTAAAAGTCCTGAAG Reverse Primer GTAGACCCCCCGGCAGAGT |
50 °C for 2 min; 95 °C for 10 min; 45 cycles of 95 °C for 15 s and 60 °C for 1 min |
| ackA |
Forward Primer CGCTTCACAACCCAGCTAACTT Reverse Primer CGCCACATGAGGGATATTCG |
50 °C for 2 min; 95 °C for 10 min; 45 cycles of 95 °C for 15 s and 60 °C for 1 min |
Evaluation of biofilm units (BU)
BU was evaluated in 96-well flat-bottomed Nunclon microtiter polystyrene plates as illustrated earlier [6, 12]. All strains were grown up to the mid-log phase in both BHI and LB broths. The grown mid-log phase cultures were diluted in BHI broth and 200 μl of diluted cells was added to individual wells and incubated for 1 day at 37 °C, followed by being washed softly with 0.1 M phosphate-buffered saline pH 7.4 and air-dried. The bound biofilms were stained with 0.4% crystal violet. Absorbance was recorded at 570 nm for the calculation of Abiofilm. Simultaneously Agrowth was determined for cultures grown in LB and BHI broths under static conditions at 37 °C for 24 h by taking absorbance at 570 nm. The BU was calculated by using the following formula: BU = Abiofilm/Agrowth [6, 12].
In silico analysis of ackA
ackA amino acid sequence of S. aureus ATCC12600 was analyzed by using the NCBI-BLAST and Clustal X tool. The multiple sequence alignment was performed between S. aureus ackA sequence with Mycobacterium avium, Salmonella typhimurium, Methanosarcina thermophila, and E. coli using ClustalX software. The crystal structure of S. aureus ackA was not available in the PDB; therefore, S. aureus ackA structure was built from its sequence (KC954623.1) by using the online SWISS-MODEL tool. The structural comparisons of S. aureus ackA structure with other bacterial ackA structures were carried out using PyMOL. An alignment of superimposed structures and similarities were predicted and the differences in the structures were expressed in terms of root means square deviation (RMSD) values for the Mycobacterium avium (3P4I) and Salmonella typhimurium (3SLC) [55].
Statistical analysis
All the experiments were performed AQ2 two times (n = 2) and all the values were given as mean ± standard deviation of the mean (SD). Statistics analysis was evaluated using two-way ANOVA with p-value < 0.05.
Results
Characterization of S. aureus acetate kinase (ackA)
S. aureus ATCC12600 acetate kinase (ackA) gene was PCR amplified (Fig. 1a) and the resultant PCR product of ackA (1.2 Kb) gene was ligated into Sal I and Hind III sites of pQE 30 vector and transformed into E. coli DH5α; the positive recombinant clones were identified and confirmed by PCR and sequencing (Table 1) The resultant clone was named PS ackA and the sequence was submitted to GenBank (Accession number: KC954623.1). The ackA gene expression was successfully induced with 1 mM IPTG in PS ackA clone. The recombinant ackA was purified by passing through the nickel-metal chelate affinity column. The purity of the recombinant ackA was assessed on 10% SDS-PAGE, and the results showed a single band with a molecular weight of 44 KD corresponding to the insert cloned (Fig. 1b). The ackA gene sequence when BLAST searched resembled all the ackA gene sequences reported for other strains of S. aureus in the database.
Fig. 1.
PCR amplification, expression, and purification of S. aureus ATCC 12600 ackA (a) polymerase chain reaction of ackA from genomic DNA of S. aureus ATCC 12600: where Lane M is 100 bp DNA ladder, Lane 1 is PCR product of ackA gene (1.2 Kb) (b) 10% SDS-PAGE analysis of expressed recombinant ackA in E. coli DH5α: Lane M is medium range protein molecular weight marker obtained from Bangalore Genei pvt ltd India, Lane 1 is purified recombinant ackA of clone PSackA induced with 1 mM IPTG showing a molecular weight of 44 kDa
The ackA amino acid sequence analysis (GenBank: KC954623.1) indicated the presence of (i) ACKA-1 (5–16 amino acids), (ii) ACKA-2 (215–222 amino acids), (iii) ATP binding site present inside the ACKA-2 domain, and (iv) interestingly, presence of five serine/threonine phosphorylation sites (Fig. 2). This organization of ackA explains that in S. aureus, the functioning of ackA is regulated by serine/threonine protein kinase.
Fig. 2.
S. aureus ATCC12600 acetate kinase amino acid sequence alignment and PROSITE results showing ATP binding site, 5 serine-threonine kinase phosphorylation sites
S. aureus ackA structural analysis
In multiple sequence alignment of ackA protein sequence showed conspicuous variations with Mycobacterium avium, Salmonella typhimurium, Methanosarcina thermophila, and E. coli (Fig. 3a). The S. aureus ackA structure built using the SWISS-MODEL (Fig. 3b) when compared with the ackA structures of Mycobacterium avium (PDB: 3P4I) and Salmonella typhimurium (PDB: 3SLC) showed very low structural homology as indicated from the RMSD values 1.877 Å, 2.141 Å respectively (Fig. 3c, d). The identical regions were distributed randomly throughout the alignment. These results indicate the uniqueness of the S. aureus ackA structure.
Fig. 3.
Multiple sequence alignment and structural analysis of S. aureus ATCC12600 ackA. a Multiple sequence alignment of ackA amino acid sequence of S. aureus ATCC12600 with Mycobacterium avium, Salmonella typhimurium, Methanosarcina thermophila, and E. coli ackA. b S. aureus ATCC12600 ackA structure built by using SWISS-MODEL and expressed in PyMOL program (blue). c PyMOL visualization and structural superimposition of ackA structure of S. aureus ATCC 12600 with Mycobacterium avium ackA green (3P4I) exhibited 1.877 Å RMSD value. d PyMOL visualization structural superimposition of ackA structure of S. aureus ATCC 12600 with Salmonella typhimurium ackA light orange (3SLC) exhibited 2.141 Å RMSD value
Enzyme kinetics
Acetate kinase activity was identified in the cytosolic fraction of S. aureus ATCC12600 (2.85 ± 0.05 μM NADH/min/ml), while the recombinant ackA exhibited an activity of 3.35 ± 0.05 μM NADH/ml/min which was close to the native S. aureus ATCC12600. Distinct differences were noted when S. aureus ackA activity was compared to that of other prokaryotes (Table 3), indicating the uniqueness of this activity in S. aureus, which allows them to survive in a variety of environments, particularly in multidrug-resistant strains. The ackA activities were determined in the cytosolic fraction of multidrug-resistant strains of S. aureus grown in LB and BHI broths, which indicated higher ackA activity was observed in the multidrug-resistant strains of S. aureus grown in BHI broth compared to LB broth. Although multidrug-resistant strains showed higher ackA activity compared to drug-sensitive S. aureus ATCC12600 strain, the ackA activity in methicillin-resistant strains of S. aureus (LMV 3–5) (MRSA) strains was highly pronounced (Fig. 4a). These findings indicate that acetate requirement is high in multidrug-resistant S. aureus especially in MRSA.
Table 3.
Acetate kinase (ackA) activity in various microorganisms
| Organism | ackA Activity (μm/min/ mg or μm/min/ ml) | References |
|---|---|---|
| Lactobacillus sanfranciscensis | 14.8 | Knorr, R et al. 2001 [56] |
| E. coli JM109 | 2.1 | Knorr, R et al. 2001 [56] |
| Mycobacterium tuberculosis | 0.948 | Rücker et al. 2015 [57] |
| Desulfovibrio piger Vib-7 | 1.52 | Kushkevych IV. 2014 [58] |
| Desulfomicrobiu sp. Rod-9 | 0.46 | Kushkevych IV. 2014 [58] |
| Shewanella sp. AS-11 | 56,640 U | Tang et al.2012 [59] |
| Clostridium ultunense | 0.96 | Anna Schnürer et al. 1997 [60] |
| Clostridium acetobutylicurn | 401 U | Winzer et al. 1997 [61] |
| Acholeplasma laidlawii | 268 u | Kahane I and A Muhlrad. 1979 [62] |
| Methanosarcina thermophila | 196.4 | Aceti and Ferry. 1988 [53] |
| Salmonella typhimurium | 20.6 | Fox and Roseman. 1986 [63] |
| Staphylococcus aureus ATCC 12600 | 3.35 | This study |
Fig. 4.

Analysis of ackA enzyme activity, expression, and biofilm units in different strains of S. aureus grown in LB and BHI broths. a ackA activity in all strains of S. aureus and the activity was expressed as μM of NADH formed for ml per minute. b Quantitative real-time PCR analysis of ackA gene in different strains of S. aureus. c The in vitro estimation of BU in different strains of S. aureus and BU was calculated by using the following formula: BU = Abiofilm/Agrowth. Two-way ANOVA statistical significance: *p > 0.05, **p ≤ 0.05, ***p ≤ 0.01, ****p ≤ 0.001, and *****p ≤ 0.0001
Biofilm assay
Biofilm units (BU) were estimated for all the strains of S. aureus used in the present study grown in LB and in BHI broths. Elevated BU was observed in multidrug-resistant strains of S. aureus grown in BHI broth compared to all the S. aureus strains grown in LB broth. Interestingly, MRSA strains exhibited much higher BU compared to all other strains used in the present study in both the broths (Fig. 4c). These findings explain that multidrug-resistant strains of S. aureus particularly MRSA strains are more pathogenic in nature.
Quantification of ackA gene expression using qPCR
The relative expression of the ackA gene in drug-resistant strains of S. aureus grown in LB and BHI broths was quantified against DNA gyrase expression as an endogenous control. The high expression of ackA was observed in all the S. aureus strains grown in BHI broth compared to the strains grown in LB broth. Among them, multidrug-resistant strains of S. aureus showed 1.37-folds of higher ackA gene expression compared to drug-sensitive S. aureus ATCC12600. Between multidrug-resistant strains of S. aureus, MRSA strains demonstrated 0.88-fold elevated expression (Fig. 4b). This elevated ackA gene expression aptly correlated with increased BU in multidrug-resistant strains of S. aureus, particularly MRSA strains. All these results explain that the requirement of acetate and acetyl phosphate drives the formation of higher BU in multidrug-resistant strains of S. aureus and in MRSA strains; thereby, ackA gene expression is involved in the pathogenesis of S. aureus, especially MRSA.
Discussion
Staphylococcus aureus is a versatile pathogen that can survive in diverse niches and its versatility is based on its capacity to obtain and utilize nutrients from a variety of sources and respond by modifying gene expression; therefore, the metabolic signals encountered by bacteria not only aid in their survival in harsh conditions, but also play an important role in pathogenesis [5, 7, 14, 20, 47]. During growth under aerobic conditions, the end product of the glycolytic pathway, pyruvate, is decarboxylated to acetyl-coenzyme A. This acetyl-coenzyme A is converted to acetyl phosphate that is used to produce ATP and acetate and excess acetate is excreted into the culture medium during the exponential phase of growth, yet during the stationary phase of growth, when nutrient availability is minimal, S. aureus utilizes accumulated acetate as a carbon source via acetate kinase (ackA) [33, 36, 37]. In this process, acetate kinase is a key enzyme responsible for the dephosphorylation of acetyl phosphate with the concomitant production of acetate and ATP during anaerobic growth [33, 36, 64, 65]; the present study results concur with these findings. We have observed elevated ackA gene expression and enzyme activity in multidrug-resistant strains of S. aureus grown in BHI broth; interestingly, in MRSA strains, this was more noticeable (Fig. 4a, b).
The gene encoding acetate kinase (ackA) was cloned and expressed in the E. coli DH5α and the pure recombinant ackA exhibited similar enzyme activity to that of native ackA (Fig. 1). The sequence analysis revealed that ackA of S. aureus was showing a distinct presence of S and T phosphorylating sites and an ATP binding site; this explains that ackA may be regulated by serine/threonine kinase [65]. The uniqueness of ackA function in various organisms is very much noted (Table 3); we also observed subtle structural variations between ackA of S. aureus and Mycobacterium avium (PDB: 3P4I), and Salmonella typhimurium (PDB:3SLC) (Fig. 3), which are associated with ackA function (Table 3) explaining the ackA functions are exclusively placed in bacteria [45, 46, 48, 66]. The elevated ackA activity and biofilm formation observed in MRSA strains indicate the ackA involvement in the biofilm formation (Fig. 4c) [23, 42–44]. Earlier studies from our laboratory showed elevated biofilm formation in MDR strains of S. aureus grown in BHI broth and more particularly in MRSA strains [12, 27], and the present study results also reconfirm (Fig. 4c). The interesting fact increased ackA expression and activity observed in MDR strains and in particular MRSA strains [5–8, 11, 40, 42] largely reveal that the acetyl phosphate whose forms changed due to acetate kinase activity participated in the anabolic biosynthesis of energy generation (Fig. 5). These findings suggest that higher biosynthesis means elevated rate of biofilm formation, which is a pathogenic factor of S. aureus; therefore, increased acetate kinase activity made greater availability of acetate and ATP, which actively participated in synthesis, leading to biofilm formation (Fig. 5) [33, 39, 40, 42, 51, 65, 66]. Thus, substrate-level phosphorylation remains a conserved and crucial mechanism in which gene disruption leads to a lethal condition [36, 39, 41, 44]. The findings of the present study indicate elevated ackA activity and expression correlated with increased biofilm units in multidrug-resistant strains of S. aureus explaining the acetate build-up profoundly increases the pathogenicity in MDR strains of S. aureus in particular MRSA (Fig. 5) [40, 42, 66].
Fig. 5.
In MRSA under reductive conditions elevated ackA activity increases biofilm units
Conclusion
Acetate kinase is a central enzyme that is essential for the survival of S. aureus in different environmental conditions. In the current study, we have observed elevated acetate kinase activity, expression, and increased BU in multi-drug resistant strains of S. aureus, especially in MRSA strains, which indicates the drug resistance character elevates pathogenicity in multidrug-resistant strains of S. aureus and MRSA. Further, distinct structural differences were noted between ackA of S. aureus and other bacteria. All these findings explain the acetate build-up profoundly increases the survival capacity and pathogenicity in drug-resistant strains of S. aureus via biofilm formation which is the pathogenic factor in MRSA.
Acknowledgements
We sincerely acknowledge Sri Venkateswara Institute of Medical Sciences and University, for providing facilities to carry out this work.
Abbreviations
- ackA
Acetate kinase
- acCoA
Acetyl-coenzyme A
- Acetyl-P
Acetyl phosphate
- ATCC
American Type Culture Collection
- BHI
Brain heart infusion
- BLAST
Basic Local Alignment Search Tool
- BU
Biofilm units
- cDNA
Complimentary DNA
- D
Dairy herd
- CA-MRSA
Community-associated methicillin-resistant S. aureus
- EDTA
Ethylene diamine tetra acetic acid
- EPS
Extracellular polymeric substance
- IPTG
Isopropyl β-d-1-thiogalactopyranoside
- LB
Luria-Bertani
- LMV
Local Milk Vendor
- MDR
Multidrug resistant
- MRSA
Methicillin-resistant Staphylococcus aureus
- PDB
Protein data bank
- PCR
Polymerase chain reaction
- Pta-AckA
Phosphotrans-acetylase-acetate kinase
- pQE 30
Plasmid QIAGEN 30
- SDS-PAGE
Sodium dodecyl sulphate–polyacrylamide gel electrophoresis
- RMSD
Root means square deviation
- TCA
Tricarboxylic acid cycle
Authors’ contributions
PVGK conceived the idea; SSR and AK conducted the experiments; SSR and PVGK analyzed the data; SSR and PVGK prepared the manuscript.
Funding
Sri Venkateswara Institute of Medical Sciences, Tirupati, India, AP:517507.
Availability of data and materials
The data presented in the manuscript are available with the corresponding author who can be contacted at a reasonable time.
Some of the data that is Cloning of ackA available with Gen bank (accession no: KC954623.1).
Declarations
Ethics approval and consent to participate
This article does not contain any studies with human participants or animals performed by any of the authors.
Consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
Footnotes
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Tong SY, Davis JS, Eichenberger E, Holland TL, Fowler VG. Staphylococcus aureus infections: epidemiology, pathophysiology, clinical manifestations, and management. Clin Microbiol Rev. 2015;28(3):603–661. doi: 10.1128/CMR.00134-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Pollitt EJG, Szkuta PT, Burns N, Foster SJ. Staphylococcus aureus infection dynamics. PLoS Pathog. 2018;14(6):e1007112. doi: 10.1371/journal.ppat.1007112. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Taylor TA, Unakal CG. Staphylococcus aureus. [Updated 2022 Feb 14]. In: Stat Pearls. Treasure Island (FL): Stat Pearls Publishing; 2022 https://www.ncbi.nlm.nih.gov/books/NBK441868
- 4.Balasubramanian D, Harper L, Shopsin B, Torres VJ. Staphylococcus aureus pathogenesis in diverse host environments. Pathogens and disease. 2017;75(1):ftx005. doi: 10.1093/femspd/ftx005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Onyango LA, Alreshidi MM. Adaptive metabolism in staphylococci: survival and persistence in environmental and clinical settings. J Pathog. 2018;2018:1092632. doi: 10.1155/2018/1092632. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Amaral MM, Coelho LR, Flores RP, Souza RR, Silva-Carvalho MC, Teixeira LA, Ferreira-Carvalho BT, Figueiredo AM. The predominant variant of the Brazilian epidemic clonal complex of methicillin-resistant Staphylococcus aureus has an enhanced ability to produce biofilm and to adhere and invade airway epithelial cells. J Infect Dis. 2005;192(5):801–810. doi: 10.1086/432515. [DOI] [PubMed] [Google Scholar]
- 7.Howden BP, Giulieri SG, Wong Fok Lung T, Baines SL, Sharkey LK, Lee JYH, Hachani A, Monk IR, Stinear TP. Staphylococcus aureus host interactions and adaptation. Nat Rev Microbiol. 2023;27:1–16. doi: 10.1038/s41579-023-00852-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Somerville GA, Proctor RA. At the crossroads of bacterial metabolism and virulence factor synthesis in staphylococci. Microbiol Mol Biol Rev. 2009;73:233–248. doi: 10.1128/MMBR.00005-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Schilcher K, Horswill AR. Staphylococcal biofilm development: structure, regulation, and treatment strategies. Microbiol Mol Biol Rev. 2020;84(3):e00026–19. doi: 10.1128/MMBR.00026-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Idrees M, Sawant S, Karodia N, Rahman A. Staphylococcus aureus biofilm: morphology, genetics, pathogenesis and treatment strategies. Int J Environ Res Public Health. 2021;18(14):7602. doi: 10.3390/ijerph18147602. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Tomlinson BR, Malof ME, Shaw LN. A global transcriptomic analysis of Staphylococcus aureus biofilm formation across diverse clonal lineages. Microb Genom. 2021;7(7):000598. doi: 10.1099/mgen.0.000598. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Yeswanth S, Chaudhury A, Sarma P. Quantitative expression analysis of SpA, FnbA and Rsp genes in Staphylococcus aureus: actively associated in the formation of biofilms. Curr Microbiol. 2017;74(12):1394–1403. doi: 10.1007/s00284-017-1331-x. [DOI] [PubMed] [Google Scholar]
- 13.Speziale P, Pietrocola G. The multivalent role of fibronectin-binding proteins A and B (FnBPA and FnBPB) of Staphylococcus aureus in host infections. Front Microbiol. 2020;26(11):2054. doi: 10.3389/fmicb.2020.02054. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Turner NA, Sharma-Kuinkel BK, Maskarinec SA, Eichenberger EM, Shah PP, Carugati M, Holland TL, Fowler VG., Jr Methicillin-resistant Staphylococcus aureus: an overview of basic and clinical research. Nat Rev Microbiol. 2019;17:203–218. doi: 10.1038/s41579-018-0147-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Tigabu A, Getaneh A (2021) Staphylococcus aureus, ESKAPE bacteria challenging current health care and community settings: a literature review. Clin Lab. Jul 1;67(7). 10.7754/Clin.Lab.2020.200930 [DOI] [PubMed]
- 16.Raineri EJM, Altulea D, van Dijl JM. Staphylococcal trafficking and infection-from ‘nose to gut’ and back. FEMS Microbiol Rev. 2022;46(1):fuab041. doi: 10.1093/femsre/fuab041. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Vestergaard M, Frees D, Ingmer H (2019) Antibiotic resistance and the MRSA problem. Microbiol Spectr 7(2). 10.1128/microbiolspec.GPP3-0057-2018 [DOI] [PMC free article] [PubMed]
- 18.Lee AS, de Lencastre H, Garau J, Kluytmans J, Malhotra-Kumar S, Peschel A, Harbarth S. Methicillin-resistant Staphylococcus aureus. Nat Rev Dis Primers. 2018;31(4):18033. doi: 10.1038/nrdp.2018.33. [DOI] [PubMed] [Google Scholar]
- 19.DeLeo FR, Otto M, Kreiswirth BN, Chambers HF. Community-associated meticillin-resistant Staphylococcus aureus. Lancet. 2010;375(9725):1557–68. doi: 10.1016/S0140-6736(09)61999-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Stryjewski ME, Corey GR. Methicillin-resistant Staphylococcus aureus: an evolving pathogen. Clin Infect Dis. 2014;58(Suppl 1):S10–S19. doi: 10.1093/cid/cit613. [DOI] [PubMed] [Google Scholar]
- 21.Suthi S, Gopi D, Chaudhary A, Sarma PVGK. The therapeutic potential of 4-methoxy-1-methyl-2-oxopyridine-3-carbamide (MMOXC) derived from ricinine on macrophage cell lines infected with methicillin-resistant strains of Staphylococcus aureus. Appl Biochem Biotechnol. 2023;195(5):2843–2862. doi: 10.1007/s12010-022-04269-w. [DOI] [PubMed] [Google Scholar]
- 22.Marzban A, Mirzaei SZ, Karkhane M, Ghotekar SK, Danesh A. Biogenesis of copper nanoparticles assisted with seaweed polysaccharide with antibacterial and antibiofilm properties against methicillin-resistant Staphylococcus aureus. J Drug Deliv Sci Technol. 2022;74:103499. doi: 10.1016/j.jddst.2022.103499. [DOI] [Google Scholar]
- 23.Donlan RM. Biofilms and device-associated infections. Emerg Infect Dis. 2001;7:277–281. doi: 10.3201/eid0702.010226. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Neopane P, Nepal HP, Shrestha R, Uehara O, Abiko Y. In vitro biofilm formation by Staphylococcus aureus isolated from wounds of hospital-admitted patients and their association with antimicrobial resistance. Int J Gen Med. 2018;11:25–32. doi: 10.2147/IJGM.S153268. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Deepika G, Subbarayadu S, Chaudhary A, Sarma PVGK. Dibenzyl (benzo [d] thiazol-2-yl (hydroxy) methyl) phosphonate (DBTMP) showing anti-S. aureus and anti-biofilm properties by elevating activities of serine protease (SspA) and cysteine protease staphopain B (SspB) Arch Microbiol. 2022;204(7):397. doi: 10.1007/s00203-022-02974-y. [DOI] [PubMed] [Google Scholar]
- 26.Swarupa V, Chaudhury A, Krishna Sarma PVGK. Iron enhances the Peptidyl deformylase activity and biofilm formation in Staphylococcus aureus. Iron enhances the Peptidyl deformylase activity and biofilm formation in Staphylococcus aureus. 3 Biotech. 2018;8:32. doi: 10.1007/s13205-017-1050-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Vudhya Gowrisankar Y, Manne Mudhu S, Pasupuleti SK, Suthi S, Chaudhury A, Sarma P. Staphylococcus aureus grown in anaerobic conditions exhibits elevated glutamine biosynthesis and biofilm units. Can J Microbiol. 2021;67(4):323–331. doi: 10.1139/cjm-2020-0434. [DOI] [PubMed] [Google Scholar]
- 28.Strasters KC, Winkler KC. Carbohydrate metabolism of Staphylococcus aureus. J Gen Microbiol. 1963;33:213–229. doi: 10.1099/00221287-33-2-213. [DOI] [PubMed] [Google Scholar]
- 29.Ferreira MT, Manso AS, Gaspar P, Pinho MG, Neves AR. Effect of oxygen on glucose metabolism: utilization of lactate in Staphylococcus aureus as revealed by in vivo NMR studies. PLoS One. 2013;8(3):e58277. doi: 10.1371/journal.pone.0058277. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Gardner JF, Lascelles J. The requirement for acetate of a streptomycin-resistant strain of Staphylococcus aureus. J Gen Microbiol. 1962;29:157–164. doi: 10.1099/00221287-29-1-157. [DOI] [PubMed] [Google Scholar]
- 31.Troitzsch A, Loi VV, Methling K, Zühlke D, Lalk M, Riedel K, Bernhardt J, Elsayed EM, Bange G, Antelmann H, Pané-Farré J. Carbon source-dependent reprogramming of anaerobic metabolism in Staphylococcus aureus. J Bacteriol. 2021;203(8):e00639–20. doi: 10.1128/JB.00639-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Halsey CR, Lei S, Wax JK, Lehman MK, Nuxoll AS, Steinke L, Sadykov M, Powers R, Fey PD. Amino acid catabolism in Staphylococcus aureus and the function of carbon catabolite repression. mBio. 2017;8(1):e01434–16. doi: 10.1128/mBio.01434-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Somerville GA, Saïd-Salim B, Wickman JM, Raffel SJ, Kreiswirth BN, Musser JM. Correlation of acetate catabolism and growth yield in Staphylococcus aureus: implications for host-pathogen interactions. Infect Immun. 2003;71(8):4724–4732. doi: 10.1128/IAI.71.8.4724-4732.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Seidl K, Muller S, Francois P, Kriebitzsch C, Schrenzel J, Engelmann S, Bischoff M, Berger-Bachi B. Effect of a glucose impulse on the CcpA regulon in Staphylococcus aureus. BMC Microbiol. 2009;9:95. doi: 10.1186/1471-2180-9-95. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Collins FM, Lascelles J. The effect of growth conditions on oxidative and dehydrogenase activity in Staphylococcus aureus. J Gen Microbiol. 1962;29:531–535. doi: 10.1099/00221287-29-3-531. [DOI] [PubMed] [Google Scholar]
- 36.Sadykov MR, Thomas VC, Marshall DD, Wenstrom CJ, Moormeier DE, Widhelm TJ, Nuxoll AS, Powers R, Bayles KW. Inactivation of the Pta-AckApathway causes cell death in Staphylococcus aureus. J Bacteriol. 2013;195:3035–3044. doi: 10.1128/JB.00042-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Somerville GA, Chaussee MS, Morgan CI, Fitzgerald JR, Dorward DW, Reitzer LJ, Musser JM. Staphylococcus aureus aconitase inactivation unexpectedly inhibits post-exponential-phase growth and enhances stationary-phase survival. Infect Immun. 2002;70(11):6373–6382. doi: 10.1128/IAI.70.11.6373-6382.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Richardson AR, Somerville GA, Sonenshein AL. Regulating the intersection of metabolism and pathogenesis in gram-positive bacteria. Microbiol Spectr. 2015;3(10):1128. doi: 10.1128/microbiolspec.MBP-0004-2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Marshall DD, Sadykov MR, Thomas VC, Bayles KW, Powers R. Redox imbalance underlies the fitness defect associated with inactivation of the Pta-AckA pathway in Staphylococcus aureus. J Proteome Res. 2016;15:1205–1212. doi: 10.1021/acs.jproteome.5b01089. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Wolfe AJ. The acetate switch. Microbiol Mol Biol Rev. 2005;69(1):12–50. doi: 10.1128/MMBR.69.1.12-50.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Thomsen IP, Liu GY. Targeting fundamental pathways to disrupt Staphylococcus aureus survival: clinical implications of recent discoveries. JCI Insight. 2018;3(5):e98216. doi: 10.1172/jci.insight.98216. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Wolfe AJ, Chang DE, Walker JD, Seitz-Partridge JE, Vidaurri MD, Lange CF, Prüss BM, Henk MC, Larkin JC, Conway T. Evidence that acetyl phosphate functions as a global signal during biofilm development. Mol Microbiol. 2003;48:977–988. doi: 10.1046/j.1365-2958.2003.03457.x. [DOI] [PubMed] [Google Scholar]
- 43.Zhang B, Lingga C, Bowman C, Hackmann TJ. A new pathway for forming acetate and synthesizing ATP during fermentation in bacteria. Appl Environ Microbiol. 2021;87:e0295920. doi: 10.1128/AEM.02959-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Kuit W, Minton NP, López-Contreras AM, Eggink G. Disruption of the acetate kinase (ack) gene of Clostridium acetobutylicum results in delayed acetate production. Appl Microbiol Biotechnol. 2012;94:729–741. doi: 10.1007/s00253-011-3848-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Tiwari S, Barh D, Imchen M, Rao E, Kumavath RK, Seenivasan SP, Jaiswal AK, Jamal SB, Kumar V, Ghosh P, Azevedo V. Acetate kinase (AcK) is essential for microbial growth and Betel-derived compounds potentially target AcK, PhoP and MDR proteins in M. tuberculosis, V. cholerae and pathogenic E. coli: an in silico and in vitro study. Curr Top Med Chem. 2018;18:2731–2740. doi: 10.2174/1568026619666190121105851. [DOI] [PubMed] [Google Scholar]
- 46.Chittori S, Savithri HS, Murthy MR. Structural and mechanistic investigations on Salmonella typhimurium acetate kinase (AckA): identification of a putative ligand binding pocket at the dimeric interface. BMC Struct Biol. 2012;12:24. doi: 10.1186/1472-6807-12-24. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.De Mets F, Van Melderen L, Gottesman S. Regulation of acetate metabolism and coordination with the TCA cycle via a processed small RNA. Proc Natl Acad Sci U S A. 2019;116:1043–1052. doi: 10.1073/pnas.1815288116. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Asgari S, Shariati P, Ebrahim-Habibi A. Targeting acetate kinase: inhibitors as potential bacteriostatics. J Microbiol Biotechnol. 2013;23:1544–1553. doi: 10.4014/jmb.1305.05026. [DOI] [PubMed] [Google Scholar]
- 49.Naorem RS, Pangabam BD, Bora SS, Goswami G, Barooah M, Hazarika DJ, Fekete C. Identification of putative vaccine and drug targets against the methicillin-resistant Staphylococcus aureus by reverse vaccinology and subtractive genomics approaches. Molecules. 2022;27(7):2083. doi: 10.3390/molecules27072083. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Swarupa V, Rupa Sundari A, Prasad UV, Yeswanth S, Hari Prasad O, Sarma PVGK. Identification of methicillin resistant Staphylococcus aureus in raw cow milk through amplification of mecA. J Pure Appl Microbiol. 2014;8:4909–4915. [Google Scholar]
- 51.Prasad UV, Vasu D, Yeswanth S, Swarupa V, Sunitha MM, Choudhary A, Sarma PV. Phosphorylation controls the functioning of Staphylococcus aureus isocitratedehydrogenase–favours biofilm formation. J Enzyme Inhib Med Chem. 2015;30(4):655–661. doi: 10.3109/14756366.2014.959945. [DOI] [PubMed] [Google Scholar]
- 52.Ren NQ, Lin HL, Zhang K, Zheng GX, Duan ZJ, Lin M. Cloning, expression, and characterization of an acetate kinase from a high rate of biohydrogen bacterial strain Ethanoligenenssp. hit B49. Curr Microbiol. 2007;55:167–172. doi: 10.1007/s00284-007-0172-4. [DOI] [PubMed] [Google Scholar]
- 53.Aceti DJ, Ferry JG. Purification and characterization of acetate kinase from acetate-grown Methanosarcina thermophila. Evidence for regulation of synthesis. J Biol Chem. 1988;263(30):15444–15448. doi: 10.1016/S0021-9258(19)37608-2. [DOI] [PubMed] [Google Scholar]
- 54.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
- 55.Kumar PS, Kumar YN, Prasad UV, Yeswanth S, Swarupa V, Vasu D, Venkatesh K, Srikanth L, Rao VK, Sarma PV. Comparative structural and functional analysis of Staphylococcus aureus glucokinase with other bacterial glucokinases. Indian J Pharm Sci. 2014;76:430–436. [PMC free article] [PubMed] [Google Scholar]
- 56.Knorr R, Ehrmann MA, Vogel RF (2001) Cloning of the phosphotrans acetylase gene from Lactobacillus sanfranciscensis and characterization of its gene product. J Basic Microbiol 41:339–349. 10.1002/1521-4028(200112)41:63.0.CO;2-0 [DOI] [PubMed]
- 57.Rücker N, Billig S, Bücker R, Jahn D, Wittmann C, Bange FC (2015) Acetate Dissimilation and Assimilation in Mycobacterium tuberculosis Depend on Carbon Availability. J Bacteriol 197:3182–3190. 10.1128/JB.00259-15 [DOI] [PMC free article] [PubMed]
- 58.Kushkevych IV (2014) Acetate kinase Activity and Kinetic Properties of the Enzyme in Desulfovibrio piger Vib-7 and Desulfomicrobium sp. Rod-9 Intestinal Bacterial Strains. Open Microbiol J 8:138–143. 10.2174/1874285801408010138 [DOI] [PMC free article] [PubMed]
- 59.Tang MA, Motoshima H, Watanabe K (2012) Cloning, expression and purification of cold adapted acetate kinase from Shewanella species AS-11. African Journal of Biotechnology 11(29).
- 60.Anna Schnürer, Bo H Svensson, Bernhard Schink (1997) Enzyme activities in and energetics of acetate metabolism by the mesophilic syntrophically acetate-oxidizing anaerobe Clostridium ultunense. FEMS Microbiol Lett 154:331–336. 10.1111/j.1574-6968.1997.tb12664.x
- 61.Winzer K, Lorenz K, DÜrre P (1997) Acetate kinase from Clostridium acetobutylicum: a highly specific enzyme that is actively transcribed during acidogenesis and solventogenesis. Microbiology 143:3279–3286. 10.1099/00221287-143-10-3279 [DOI] [PubMed]
- 62.Kahane I, Muhlrad A (1979) Purification and properties of acetate kinase from Acholeplasma laidlawii. J Bacteriol 137:764–772. 10.1128/jb.137.2.764-772.1979 [DOI] [PMC free article] [PubMed]
- 63.Fox DK, Roseman S (1986) Isolation and characterization of homogeneous acetate kinase from Salmonella typhimurium and Escherichia coli. J Biol Chem 261:13487–13497. [PubMed]
- 64.Fuchs S, Pané-Farré J, Kohler C, Hecker M, Engelmann S (2007) Anaerobic gene expression in Staphylococcus aureus. J Bacteriol 189(11):4275–4289. 10.1128/JB.00081-07 [DOI] [PMC free article] [PubMed]
- 65.Vasu D, Sunitha MM, Srikanth L, Swarupa V, Prasad UV, Sireesha K, Yeswanth S, Kumar PS, Venkatesh K, Chaudhary A, Sarma PV (2015) In Staphylococcus aureus the regulation of pyruvate kinase activity by serine/threonine-protein kinase favors biofilm formation. 3 Biotech 5:505–512. 10.1007/s13205-014-0248-3 [DOI] [PMC free article] [PubMed]
- 66.Chan SH, Nørregaard L, Solem C, Jensen PR (2014) Acetate kinase isozymes confer robustness in acetate metabolism. PLoS One 9(3):e92256. 10.1371/journal.pone.0092256 [DOI] [PMC free article] [PubMed]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The data presented in the manuscript are available with the corresponding author who can be contacted at a reasonable time.
Some of the data that is Cloning of ackA available with Gen bank (accession no: KC954623.1).




