Abstract
The pathogenesis of avian leukosis virus subgroup J (ALV-J) is complex and our understanding of it is limited. Based on our previous research, we explored the relationship between ALV-J infection and regulatory factor 1&7 (IRF1 and IRF7), interferon beta (IFNβ), and the newly identified long noncoding RNA IRF1 (LncIRF1). LncIRF1 is 1603 nt and exists in the cytoplasm and nucleus. After the occurrence of ALV-J infection, the expression levels of LncIRF1, IRF1, IRF7, and IFNβ varied in different chicken tissues. In DF1 cell lines of chicken embryo fibroblast cells (DF1 cells) the expression levels of LncIRF1, IRF7, IRF1, and IFNβ increased when ALV-J infection. Similarly, after LncIRF1 overexpression and the ALV-J challenge, the expression levels of IRF1, IRF7, and IFNβ increased, while increased LncIRF1 inhibited the proliferation of DF1 cells. Interference with LncIRF1 did not affect IRF1, IRF7, and IFNβ. However, expression levels of IRF1, IRF7, and IFNβ decreased due to LncIRF1 interference after the ALV-J challenge. An assay of the RNA-binding domain abundant in apicomplexans indicated that most of the proteins bound to LncIRF1 are related to cell proliferation and viral replication and these proteins also interact with IRF1, IRF7, and IFNβ. We suggest that LncIRF1 plays an important immunomodulatory role in the anti-ALV-J response.
Supplementary Information
The online version contains supplementary material available at 10.1007/s13205-023-03773-y.
Keywords: ALV-J, IRF1, IRF7, IFNβ, LncIRF1
Introduction
Avian leukosis virus (ALV) is a retrovirus consisting of 11 subgroups named ALV-A to ALV-K (Li et al. 2016; Payne et al. 1991). ALV-J has caused great harm to the global chicken industry (Payne and Nair 2012), and its infection mainly causes immunosuppression and tumors in chickens (Feng et al. 2016). To date, no effective vaccine has been developed against the virus, and the main measure to manage the disease is depopulation.
Long noncoding RNA (LncRNA) is a class of long RNAs that have a length of more than 200 nt, no protein-coding ability (although some encode small peptides known as micropeptides (Choi et al. 2019)) and are widely found in cells. LncRNA can regulate biological physiological processes at epigenetic, transcriptional, and post-transcriptional levels (Wei et al. 2017; Zhang et al. 2019). LncRNA has a close relationship with virus infection. LncRNA-CMPK2 is strongly up-regulated in hepatitis C virus (HCV) infected liver cells, and Kambara et al. (2014) found that its knockdown can reduce HCV replication by up-regulating interferon expression. In hepatitis B virus (HBV) induced hepatocellular carcinoma tissues, LncRNA MAPKAPK5_AS1 is highly expressed in M2 macrophages and then transferred to hepatocellular carcinoma cells in the form of exosomes, causing the proliferation of hepatocellular carcinoma cells by interacting with c-Myc (Tao et al. 2022). Covalently closed circular DNA (cccDNA) is the transcriptional template of HBV. Sun et al. (2022) found that LINC01431 inhibits the transcription of cccDNA by reducing the acetylation of histones bound to cccDNA.
In the current work, we verified and explored the relationship between the effects of regulatory factor 1 (IRF1), regulatory factor 7 (IRF7), and interferon beta (IFNβ) with long noncoding RNA IRF1 (LncIRF1) in anti-ALV-J infection. The expression levels of LncIRF1, IRF1, IRF7, and IFNβ varied in different tissues of ALV-J-infected chickens. When DF1 cell lines of chicken embryo fibroblast cells (DF1 cells) were infected with ALV-J, the expression level of LncIRF1 was increased and positively correlated with those of IRF1, IRF7, and IFNβ. The effect of LncIRF1 overexpression and interference on ALV-J infection and DF1 cell proliferation was investigated. We concluded that our newly discovered LncIRF1 plays an important role in the host response to the ALV-J infection.
Materials and methods
Cells and viruses
DF1 cells purchased from GAINING BIOLOGICAL were seeded in six-well plates at 10 × 106 cells/uL and cultured in DMEM with 10% fetal bovine serum (Gibco, USA). The cells were incubated at 37 °C in humidified air containing 5% CO2. The DF1 cells used for the assay were passed for three generations after purchase. ALV-J specimens (virus strain: NX0101, GenBank: DQ115805.1) were provided by Associate Professor Peng Zhao from the College of Animal Science and Veterinary Medicine, Shangdong Agricultural University, China. For the virus challenge, the cells were incubated with 1/20 volume of the culture medium of viral solution per well for 1 h.
Chickens and sample collection
All procedures were approved by the Animal Care and Use Committee of Southwest University (Chongqing, China). All animal experiments were performed in accordance with the national guidelines for animal welfare. IACUC NO. Approved: IACUC-20221022-17. For the confirmation of ALV-J infection, Elisa was used to detect the ALV-J P27 antigen and PCR was applied to detect the sequencing of the viral DNA. A brief procedure for Elisa is as follows: 100 μl of the negative/positive control and the samples were added to the wells, incubated for 1 h at 37 °C, then, washing and patting dry the reaction plate. And then, adding 100 ul of the enzyme antibody, incubate for 1 h at 37 °C. When washing and patting dry the plate, add the chromogenic solution incubate for 15 min at room temperature, and measure the OD value in 630 nm. S/P = (Sample OD − Native OD)/(Positive OD − Sample OD), S/P ≥ 0.2 is positive for ALV-J and vice versa. Three ALV-J-infected and three uninfected 200-day-old Xiushan hens (Landrace, Chongqing, China) were selected from a chicken farm. Six chickens were euthanized (Using CO2), and their blood and immune organs including the spleen, bursa, thymus, and liver were harvested and immediately snap-frozen in liquid nitrogen for total RNA extraction.
Cell transfection
Smart silencer (siRNAs + ASOs), overexpressed plasmid for LncIRF1 (pcDNA-LncIRF1) and corresponding negative controls (pcDNA-NC) were synthesized by RIBOBIO (Guangzhou, China) and transfected into the DF1 cells to a final oligonucleotide concentration of 10 nmol/l using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) in accordance with the manufacturer’s instructions. In the interference assay, when DF1 cells grew to 50% density in a 24-well plate, 100 nM of the smart silencer was added; in the overexpression assay, when the DF1 cells grew to 40% density in a 12-well plate, 0.8 μg of plasmid was added for transfection. pcDNA-LncIRF1 means plasmid with LncIRF1, pcDNA-NC means empty plasmid. Sequencing information of smart silencer and map of plasmid shown in S1.
RNA Fluorescence in situ hybridization (FISH)
The DF1 cells were in situ hybridized following the standard protocol (Wang et al. 2022) using in situ hybridization kit (BersinBio, Guangzhou, China). FAM-labeled LncIRF1 FISH probes were designed and synthesized to detect LncIRF1 in DF1 cells (Forward: CTCTGCTCTGGGCTGCTG; Reverse: TGAAAGCGATGGAGGGAAGG). The DF1 cells were seeded into 24-well plates to grow them on the glass slides. The slides were first fixed in 4% paraformaldehyde solution and dehydrated using an ethanol gradient. The hybridization reaction solution was then dropped on the sample. Denaturation was carried out at 73 °C for 5 min, and the samples were then quickly transferred to 53 °C for hybridization and placed overnight at 53 °C. After the background was eluted, the nuclei were stained with DAPI. The target LncRNA was photographed under a confocal laser microscope.
RNA extraction and quantitative real-time polymerase chain reaction (qRT-PCR)
Total RNA was extracted from cells using Trizol reagent (Invitrogen, Carlsbad, CA, USA) and then reversely transcribed into cDNA using a Reverse Transcription Kit (Takara, Tokyo, Japan). qRT-PCR was conducted to detect mRNA and LncRNA expression by utilizing SYBR® Premix Ex Taq™ (Takara) on Bio-RAD (US) following the protocols. mRNA expression was normalized to glyceraldehyde‐3‐phosphate dehydrogenase expression level. Each experiment was replicated thrice, and the relative expression was calculated utilizing the 2−∆∆Ct method. All primers involved are listed in Table 1.
Table 1.
Primers of qRT-PCR
| Primer name | Primer sequence |
|---|---|
| LncIRF1 |
Forward: CTGGATTGCTCCATACCTG Reverse: GCTCACGCTTGGCACATT |
| IRF1 |
Forward: GCAGAACGACTAACCAGCACTCC Reverse: ATCGGCATCCTCCAGTCGGT |
| IRF7 | Forward: TTGCACAGAGCTCCGGGACT |
| Reverse: TTGGACTCCTTGGGCTTTGTG | |
| IFNβ | Forward: CCTCAACCAGATCCAGCATT |
| Reverse: GGATGAGGCTGTGAGAGGAG | |
| ALV-J |
Forward: AGAAAGACCCGGAGAAGAC Reverse: ACACGTTTCCTGGTTGTT |
5ʹ and 3ʹ rapid amplification of cDNA ends (RACE)
Full-length sequences of LncIRF1 were obtained using an Invitrogen GeneRacer™ Kit (Invitrogen, USA) following the standard protocol (Lee and Taylor 1990). Nested PCR reactions were performed. Primers were designed and synthesized to obtain 5ʹ cDNA end products (rIRF1-R1: CGAGGGCGCTGAGCACAGTAAATG; rIRF1-R2: GGGAAGGGTCAGCAGCATTAGAGGTT) and 3ʹ cDNA end products (rIRF1-F1: GTCTCTGGAGATGTCTCCTTGGCAGGAT; rIRF1-F2: CCAGAGTGCAGCAAAGGGCAGCTT). RACE PCR products were cloned into the pcDNA3.1 cloning vector and sequenced (Sanger method) by Sangon Biotech (Shanghai, China).
Cell viability assay
The proliferative capabilities of DF1 cells that received different treatments were analyzed using a Cell-Counting Kit 8 (CCK8 Trans Gen Biotech, Beijing, China) reagent. The DF1 cells were seeded in 96-well plates and cultured in a growth medium. After treatment, their proliferative capabilities were detected at 36, 48, and 72 h. The OD value was measured using Model 680 Microplate Reader (Bio-Rad, Hercules, California, USA) at a wavelength of 450 nm.
Ethynyl deoxyuridine (EdU) assay
The DF1 cells were seeded into 12-well plates. When the cells grew to a density of 60% confluence, they were transfected with pcDNA-LncIRF1 and/or challenged ALV-J. After transfection and challenge for 48 h, the DF1 cells were exposed to 50 μmol/L EdU (RiboBio, China) at 37 °C for 2 h, fixed in 4% paraformaldehyde for 30 min, neutralized using 2 mg/mL glycine solution, and permeabilized by adding 0.5% Triton X-100. After a solution containing EdU (Apollo Reaction Cocktail; RiboBio, China) was added, the cells were incubated at room temperature for 30 min. Nuclear stain Hoechst 33,342 was then added, and incubation was continued for another 30 min. The number of EdU-stained cells were visualized by capturing capture three randomly selected fields using a fluorescence microscope (DMi8; Leica, Germany).
RNA antisense purification (RAP) assay
The biotin-labeled probes of LncIRF1 and control were designed by BersinBio (Guangzhou, China). More than 4 × 107 DF1 cells were harvested and subjected to RAP assay using the RAP kit (BersinBio, Guangzhou, China) in accordance with the standard protocol (Xing et al. 2022). Briefly, crosslinked cells were lysed, sonicated, and hybridized with the probes for 4 h at 37 °C. Next, the hybridization mixture was incubated with magnetic beads for 1 h. The bound proteins were then washed and purified for subsequent analysis. Subsequently, the proteins were digested by trypsin and the resulting peptides were identified by LC–MS.
Enrichment analysis
Gene ontology (GO) (Harris 2004) and Kyoto encyclopedia of genes and genomes (KEGG) (Ogata et al. 1999) were used to analyze LncIRF1 pull-down proteins. We identified the genes of each term in the mapping database GO and calculated the number of genes in each term and created a GO function gene list and statistics. KEGG pathway was used to identify pathways significantly enriched in genes compared with the entire genome background via a hypergeometric test. The most important biochemical metabolic pathways and signal transduction pathways were determined through significant enrichment pathway analysis. The corrected p value of ≤ 0.01 was considered statistically significant.
Protein extraction and Western blot (WB) analysis
Aggregate proteins in DF1 cells were extracted by utilizing RIPA buffer (Beyotime), and protein concentrations were quantified using a BCA Protein Assay Kit (Beyotime, Nantong, China). Equal quantities of samples were separated by utilizing 10% SDS-PAGE gel before being added to the PVDF membrane (Millipore, Boston, MA, USA). The membranes were then blocked using the blocking solution for 1 h and then incubated overnight at 4 °C using primary antibodies (specific for chicken) against IRF1, IRF7, IFNβ, and β-actin (Abcam, MA, USA). After washing, the corresponding HRP-conjugated secondary antibodies were used for incubation at room temperature for 2 h. β-Actin served as an endogenous control. Protein bands were imaged using ECL reagent in a Tanon detection system (Thermo).
Statistical analysis
Data were analyzed by GraphPad Prism 9.0 (GraphPad Software, La Jolla, CA, USA). Differences between measured groups were analyzed via t-test and one-way analysis of variance. Data were presented as mean ± SD. “*” P < 0.05, “**”P < 0.01, “***”P < 0.001, “****”P < 0.0001.
Results
Basic information of LncIRF1
In our previous RNA-seq research based on ALV-J-infected and uninfected chickens, Lan et al. found IRF1, IRF7, and IFNβ play an important role in resistance to the ALV-J infection (Lan et al. 2017). Then, we conducted cis and trans analysis of the top 10 differentially expressed LncRNAs based on DEGs in our previous RNA-seq, and found that LncRNA ENSGALT00000069547 was highly related to IRF1. Ensembl results revealed that LncRNA ENSGALT00000069547 was located on chromosome 13, 17,571,222–17,581,477 (LncRNA ENSGALT00000069547 sequencing information shown in S2, the Array Express database with the accession number E-MTAB-5135). The upstream genes of LncRNA ENSGALT00000069547 contained SLC22A5 and SLC22A4, and the downstream genes contained IRF1 and IL5 (Fig. 1A). By the naming rules of LncRNA, we initially named LncRNA ENSGALT00000069547 as LncIRF1.
Fig. 1.
Basic information of LncIRF1. A Location information of LncIRF1 (ENSGALT00000042587, green) on chromosome obtained through Ensembl. B LncIRF1 5ʹ-RACE. C LncIRF1 3ʹ-RACE. D Fluorescence in situ hybridization shows that LncIRF1 is highly expressed in the nucleus and cytoplasm
We obtained the full-length sequence of LncIRF1 by the 5ʹ-RACE and the 3ʹ-RACE. The size of the 5ʹ-RACE product amplified by the RACE test was about 250 bp (Fig. 1B), and that of the 3ʹ-RACE product was about 230 bp (Fig. 1C). To obtain the sequence information of LncIRF1, we linked the obtained fragment to the pcDNA3.1 vector and transformed it into DH5α receptor cells. Sequencing analysis results showed that the size of the 5ʹ-RACE product was 249 bp and that of the 3ʹ-RACE product was 230 bp (sequencing information see S3; SRR11115); hence, the total length of LncIRF1 was 1603 nt (sequencing information shown in S3, SRR18911116). The distribution of LncIRF1 in DF1 cells was examined by fluorescence in situ hybridization, and the results showed that LncIRF1 was highly expressed in the cytoplasm and nucleus (Fig. 1D).
Different expression levels of LncIRF1, IRF7, IRF1, and IFNβ in chicken tissues
After obtaining the basic information of LncIRF1, we detected the expression of LncIRF1, IRF1, IRF7, and IFNβ in the liver, spleen, thymus, and bursa of 200-day-old Xiushan hens (Landrace, Chongqing, China) with or without ALV-J infection. qRT-PCR results showed that LncIRF1, IRF1, IRF7, and IFNβ were expressed in the spleen, liver, thymus, and bursa. LncIRF1 expression significantly differed for the thymus and bursa. In particular, LncIRF1 in the thymus was significantly higher in ALV-J (−) than in ALV-J ( +) (P < 0.05), and LncIRF1 in bursa was significantly higher in ALV-J ( +) than in ALV-J (−) (P < 0.01) (Fig. 2A). IRF1 expression in ALV-J ( +) spleen was significantly higher than that in ALV-J (−) (P < 0.01), but the opposite was observed in the thymus (P < 0.05) and bursa (P < 0.01) (Fig. 2B). IRF7 expression was significantly high in ALV-J (−) spleen (P < 0.01) and ALV-J ( +) bursa (P < 0.01), and no significant difference was observed for the thymus and liver (Fig. 2C). IFNβ expression in ALV-J ( +) was higher than that in ALV-J (−), and significant differences were found for the spleen (P < 0.01) and liver (P < 0.01) (Fig. 2D).
Fig. 2.
Expression levels of LncIRF1, IRF7, IRF1, and IFNβ in different organs of ALV-J-infected and uninfected chickens. A Expression of LncIRF1 in the spleen, liver, thymus, and bursa. B Expression of IRF1 in the spleen, liver, thymus, and bursa. C Expression of IRF7 in the spleen, liver, thymus, and bursa. D Expression of IFNβ in the spleen, liver, thymus, and bursa. “*”P < 0.05, “**”P < 0.01, “***”P < 0.001, “****”P < 0.0001
Expression levels of LncIRF1, IRF7, IRF1 and IFNβ in DF1 cells increased after ALV-J challenge
DF1 cells were used to investigate the changes of LncIRF1, IRF1, IRF7, and IFNβ upon ALV-J infection. When the density of the cultured DF1 cells reached about 85%, they were infected (or not) with the ALV-J. The expression of LncIRF1, IRF1, IRF7, and IFNβ was then detected at 2, 6, 12, 24, and 36 h. qRT-PCR results showed that LncIRF1 expression was significantly increased after ALV-J infection (P < 0.01) (Fig. 3A). After the DF1 cells were infected with ALV-J, the relative expression level of IRF1 gradually increased with time and was the highest at 24 h (Fig. 3B). The relative expression levels of IRF7 and IFNβ increased first and then decreased and were high at 2 and 24 h (Fig. 3C, D). Meanwhile, the overall expression level of the virus env gene increased after infection. Particularly at 36 h, its expression was significantly higher than that in the control group, indicating that ALV-J successfully infected the DF1 cells (Fig. 3E). In conclusion, the relative expression levels of LncIRF1, IRF1, IRF7, and IFNβ increased to varying degrees when the DF1 cells were infected with ALV-J.
Fig. 3.
Expression levels of LncIRF1, IRF7, IRF1, IFNβ, and env at 2 h, 6 h, 12 h, 24 h and 36 h in DF1 cells after ALV-J challenge. A LncIRF1 expression level. B IRF1 mRNA expression level. C IRF7 mRNA expression level. D IFNβ mRNA expression level. E env mRNA expression level. “*”P < 0.05, “**”P < 0.01, “***”P < 0.001, “****”P < 0.0001
Expression levels of IRF1, IRF7, and IFNβ increased after LncIRF1 overexpression
We constructed a LncIRF1 overexpressed plasmid vector using pcDNA3.1 and successfully transfected it into DF1 cells (Fig. 4A). We then explored the changes of LncIRF1 at different time points and found that its expression was the highest at 48 h after overexpression (Fig. 4B). Therefore, we explored the expression levels of IRF1, IRF7, and IFNβ at 48 h after LncIRF1 overexpression. Figure 4C–E show the changes of IRF1, IRF7, and IFNβ. Their expression levels in the overexpression group were significantly higher than those in the blank group (P < 0.01). However, their expression levels in pcDNA-NC were higher than those in the blank group, and extremely significant differences were observed in IRF7. This finding suggested that these immune-related molecules are involved in cell resistance to the plasmid. We conducted the WB test to explore whether the changes of IRF1, IRF7, and IFNβ at the protein level are consistent with those at the gene level (Fig. 4F). The results showed that in the overexpression group, IRF1 significantly increased (P < 0.05) (Fig. 4G), IRF7 was not significantly different from that in the blank group but showed an increasing trend (Fig. 4H), and IFNβ significantly increased (P < 0.01) (Fig. 4I).
Fig. 4.
Expression levels of LncIRF1, IRF7, IRF1, and IFNβ in DF1 cells after LncIRF1 overexpression. A DF1 cells were transfected with a LncIRF1 overexpression plasmid (pcDNA-LncIRF1) or plasmid empty vector (pcDNA-NC), green fluorescence indicates successful transfection. B LncIRF1 expression level. C IRF1 mRNA expression level. D IRF7 mRNA expression level. E IFNβ mRNA expression level. F After 48 h of overexpression, Western blot was used to detect the content of IRF1, IRF7, and IFNβ proteins. G–I The quantification of IRF1 IRF7, and IFNβ proteins in F. “*”P < 0.05, “**”P < 0.01, “***”P < 0.001, “****”P < 0.0001
Expression levels of IRF1, IRF7, and IFNβ increased after LncIRF1 overexpression and the ALV-J challenge
At 48 h after LncIRF1 overexpression, we subjected the DF1 cells to the ALV-J challenge and then detected the gene and protein expression levels of IRF1, IRF7, and IFNβ after another 48 h. The gene expression levels of LncIRF1, IRF1, IRF7, and IFNβ in the pcDNA-LcnIRF1 + ALV-J (−) group were significantly higher than those in the blank (ALV-J-) group (P < 0.01) (Fig. 5A). Compared with those in the ALV-J ( +) group, the expression levels of LncIRF1, IRF1, IRF7, and IFNβ significantly increased in the pcDNA-LncIRF1 + ALV-J ( +) group (P < 0.01) (Fig. 5B). The expression levels of IRF1, IRF7, and IFNβ in pcDNA-LncIRF1 + ALV-J ( +) were significantly higher than those in pcDNA-LcnIRF1 + ALV-J (−), and the expression levels of LncIRF1 showed the opposite (Fig. 5C). WB (Fig. 5D) showed that the protein expression levels of IRF1, IRF7, and IFNβ in pcDNA-LcnIRF1 + ALV-J (−) were higher than those in the blank (ALV-J-) group (Fig. 5E). However, only IRF7 and IFNβ expression was significantly different (P < 0.05) (Fig. 5E). Compared with the ALV-J ( +) group, the protein expression of IRF1 (P < 0.05), IRF7 (P < 0.05), and IFNβ (P < 0.01) significantly increased in pcDNA-LncIRF1 + ALV-J ( +) group (Fig. 5F). Although the protein expression levels of IRF1, IRF7, and IFNβ were not significantly different between pcDNA-LncIRF1 + ALV-J ( +) and pcDNA-LcnIRF1 + ALV-J (−) (P > 0.05), the expression levels in the challenged group were all higher than those in the unchallenged group (Fig. 5G).
Fig. 5.
Expression levels of LncIRF1, IRF7, IRF1, and IFNβ in DF1 cells after LncIRF1 overexpression 48 h and ALV-J challenge 48 h. A LncIRF1, IRF1, IRF7, and IFNβ mRNA expression levels in pcDNA-LncIRF1 (ALV-J-) and blank (ALV-J-). B LncIRF1, IRF1, IRF7 and IFNβ mRNA expression level in pcDNA-LncIRF1 (ALV-J +) and blank (ALV-J +) C LncIRF1, IRF1, IRF7 and IFNβ mRNA expression level in pcDNA-LncIRF1 (ALV-J +) and pcDNA-LncIRF1 (ALV-J-). D Western blot was used to detect the content of IRF1, IRF7, and IFNβ proteins in pcDNA-LncIRF1 (ALV-J +), pcDNA-LncIRF1 (ALV-J−), pcDNA-NC, blank (ALV-J−) and blank (ALV-J +). E–G The quantification of IRF1, IRF7, and IFNβ in D. “*”P < 0.05, “**”P < 0.01, “***”P < 0.001, “****”P < 0.0001
Gene expression levels of IRF1, IRF7, and IFNβ decreased due to LncIRF1 interference after ALV-J challenge
Considering that LncIRF1 is expressed in the cytoplasm and nucleus (Fig. 1C), we used siRNA + ASO to interfere with LncIRF1 expression (Fig. 6A). The results showed that the expression level of LncIRF1 in the interference group was not significantly different from that of the control group; however, an interference effect was observed (Fig. 6B). We did not detect the expression levels of IRF1, IRF7, and IFNβ.
Fig. 6.
Expression levels of LncIRF1, IRF1, IRF7, and IFNβ in DF1 cells after LncIRF1 interference. A The interfering sequence was transferred into DF1 cells, red fluorescence indicates successful transfection. B Expression level of LncIRF1 at 36 h, 48 h, and 72 h after interference. C Expression level of LncIRF1 at 24 h, 36 h, and 48 h after LncIRF1 interference and ALV-J challenge. D–F Gene expression levels of IRF1, IRF7, and IFNβ at 48 h after LncIRF1 interference and ALV-J challenge. “*”P < 0.05, “**”P < 0.01, “***”P < 0.001, “****”P < 0.0001
The DF1 cells were challenged and then subjected to LncIRF1 interference. Interference effect was observed at 48 h (Fig. 6C). Detection results after 48 h showed that the gene expression levels of IRF1, IRF7, and IFNβ significantly decreased (Fig. 6D–F).
LncIRF1 inhibited the proliferation of ALV-J-infected DF1 cells
CCK8 and EdU staining were used to analyze the effect of LncIRF1 on the proliferation of ALV-J-infected DF1 cells. CCK8 results showed that the ALV-J infection group exhibited promoted cell proliferation compared with the blank group (Fig. 7A). Compared with NC (ALV-J +), LncIRF1 overexpression inhibited the proliferation of DF1 cells at 36, 48, and 72 h. Meanwhile, the proliferation of DF1 cells at 36, 48, and 72 h was inhibited after ALV-J infection and LncIRF1 overexpression (Fig. 7B). The results of EdU staining were similar to those of CCK8, and the proliferation of DF1 cells infected with ALV-J and overexpressing LncIRF1 was significantly inhibited compared with that of the cells infected only with ALV-J (Fig. 7C, D). In conclusion, LncIRF1 overexpression inhibited the proliferation of ALV-J-infected DF1 cells.
Fig. 7.
The effect of LncIRF1 on the proliferation of DF1 cells. A Cell growth curves of DF1 cells measured by the CCK-8 kit after ALV-J infection. B Cell growth curves of DF1 cells were measured by the CCK-8 kit. Red line: ALV-J infection, blue line: overexpression LncIRF1 and ALV-J infection, black line: overexpression LncIRF1. C Results of EdU assay for DF1 cells after overexpression of LncIRF1 with or without ALV-J infection, where EdU (red) fluorescence indicates proliferation and Hoechst (blue) fluorescence indicates the nuclei. D EdU-positive cell ratio of DF1 cells after overexpression of LncIRF1 with or without ALV-J infection
LncIRF1 binds to a variety of proteins
We designed a probe to pulldown LncIRF1 by the RAP kit (Boxin Biological) in accordance with the manufacturer’s instructions. Figure 8A shows that LncIRF1 was successfully pulled, and qRT-PCR results revealed the good enrichment effect of the probes (Fig. 8B). We performed RNA pulldown, and the silver staining diagram showed proteins binding to LncIRF1 (Fig. 8C). We then carried out mass spectrometry analysis and found that LncIRF1 was mainly bound to vimentin, tubulin beta chain, and 40S ribosomal protein (Tables 2, S4). At the protein level, we did not verify that LncIRF1 binds to IRF1, IRF7, and IFNβ. We then carried out the pathway analysis of LncIRF1-bound proteins and found that they were abundant in cytoskeletal regulation by Rho GTPase, Huntington’s disease, and the integrin signaling pathway (Fig. 8D). Gene Ontology analysis indicated that nearly half of the proteins pulled by LncIRF1 were enriched to cellular process, and 7.7% of the proteins were enriched to respond to stimulus (Fig. 8E). We used the top 20 proteins for pulled LncIRF1 to perform interaction network analysis with IRF1, IRF7, and IFNβ through the STRING database. The findings showed that IRF1, IRF7, and IFNβ interact with the protein for pulled LncIRF1 (Fig. 8F).
Fig. 8.
LncIRF1 binds to a variety of proteins. A Agarose gel electrophoresis. Analysis of LncIRF1 combined with the designed probe. B qRT-PCR was used to analyze the expression of pulled LncIRF1. C Representative image of silver-stained PAGE gels showing separated proteins that bound to LncIRF1. D KEGG pathway analysis of proteins bound to LncIRF1. E GO analysis of proteins bound to LncIRF1. F The protein interaction network analysis using IRF1, IRF7, IFNβ, and the top 20 proteins of pulled LncIRF1
Table 2.
Top10 binding proteins of LncIRF1
| prot_acc | prot_name | prot_score | prot_mass | prot_pi | emPAI |
|---|---|---|---|---|---|
| sp|P09244|TBB7_CHICK | Tubulin beta-7 chain | 332 | 50,095 | 4.78 | 0.89 |
| tr|F1NJ08|F1NJ08_CHICK | Vimentin | 293 | 53,240 | 5.13 | 0.62 |
| tr|F1NYB1|F1NYB1_CHICK | Tubulin beta chain | 215 | 50,285 | 4.78 | 0.66 |
| sp|P68034|ACTC_CHICK | Actin, alpha cardiac muscle 1 | 189 | 42,334 | 5.23 | 0.83 |
| sp|P13648|LMNA_CHICK | Lamin-A | 168 | 73,348 | 6.5 | 0.19 |
| tr|F1NN16|F1NN16_CHICK | 40S ribosomal protein S7 | 119 | 22,098 | 10.09 | 0.53 |
| tr|A0A1D5NXS9|A0A1D5NXS9_CHICK | Alpha-actinin-4 | 93 | 118,178 | 5.62 | 0.06 |
| tr|A0A1D5NZ01|A0A1D5NZ01_CHICK | L-lactate dehydrogenase | 92 | 27,071 | 8.54 | 0.12 |
| tr|A0A1D5PY92|A0A1D5PY92_CHICK | 40S ribosomal protein S3a | 86 | 34,000 | 9.91 | 0.1 |
| sp|Q5ZMT0|1433E_CHICK | 14–3-3 protein epsilon | 86 | 29,326 | 4.63 | 0.24 |
Prot: protein prot_acc: protein registration number. Prot_pi: isoelectric point of protein. emPAI: protein abundance index
Discussion
After viral infection, the body will resist future viral infections from multiple aspects. LncRNA is extensively involved in the body’s antiviral response. LncISG20 inhibits influenza A virus replication by enhancing ISG20 expression (Chai et al. 2018), and LncCXCL2 inhibits neutrophil-mediated lung inflammation by inhibiting CXCL2 expression in epithelial cells during viral infection (Liu et al. 2021). In addition to its antiviral effect, high LncRNA expression may promote viral infection. Carnero et al. (2016) found that LncRNA EGOT has an antagonistic effect on the antiviral response after HCV infection, thus promoting HCV replication. Lnc-7SK also promotes HCV replication (Xiong et al. 2015). When HCV invades cells, LncR8 expression is reduced, which promotes viral replication (Hu et al. 2019).
Only a few articles focus on the relationship between LncRNA and ALV-J. Lnc-Alve1-As affects the chicken embryo’s innate immunity, and the expression of Lnc-Alve1-As is significantly inhibited in chicken macrophages infected with ALV-J (Luo et al. 2021). Lnc-LTR5B can competitively bind to the immunoglobulin on the endoplasmic reticulum, and ALV-J replication is enhanced when Lnc-LTR5B is inhibited (Chen et al. 2021).
Different interferon regulatory factors can induce the production of different interferons, and these two will interact with each other (Fujita et al. 1989; Lazear et al. 2013; Matsuyama 1993; Negishi et al. 2017). Here, we investigated the interaction between IFNβ, IRF1, IRF7 and LncIRF1. After ALV-J infected the chickens, the immune-related genes will be up-regulated in the tissues (Wang et al. 2021). Our results showed that the expression levels of IRF1, IRF7, and IFNβ increased in the spleen and liver in the infected chickens. However, the expression level of the IRF1 gene in the thymus and bursa was higher in the uninfected chickens, and that of the IRF7 in the bursa was higher in the uninfected chickens. We hypothesized that these chickens were in the immunosuppressed stage. For example, HIV infection can reduce the expression levels of IRF1 (Card et al. 2013) and IFNα (Chung et al. 2012). No significant difference in LncIRF1 was observed in the spleen and liver tissues. However, in the thymus, LncIRF1 was higher in the uninfected group than in the infected group. In the bursa, LncIRF1 was higher in the infected group than in the uninfected group.
LncIRF1 prevents ALV-J infection by regulating IRF1, IRF7, and IFNβ. The expression level of LncIRF1 was positively correlated with that of IRF1, IRF7, and IFNβ. After overexpression of LncIRF1, the gene and protein expression levels of IRF1, IRF7, and IFNβ were elevated. When overexpressed LncIRF1 and then infected with the virus, the gene and protein expression levels of IRF1, IRF7, and IFNβ were significantly higher than that of the group infected with the virus only (Fig. 5B, F). When we interfered with LncIRF1 after reinfection with the virus, the expression of IRF1, IRF7, and IFNβ were significantly lower than that of the group infected with the virus only (Fig. 6D–F). During the replication cycle of various viruses, vimentin may provide the physical scaffolding required for initial viral replication, preventing viral proteins from spreading into the cytoplasm (Burch et al. 2013). Vimentin may be associated with the tumorigenic effect of ALV-J and is closely related to the degree of malignancy, invasion ability, and apoptosis of tumor cells (Havel et al. 2015; Satelli and Li 2011). LncIRF1 was also enriched in tubulin β chains. Microtubules are composed of α/β tubulin, which is an important component of the spindle (Nogales 2001). The depolymerization and polymerization of tubulin are in a dynamic balance; when this balance is broken, the mitosis of cells can be blocked, resulting in abnormal tubulin function and consequently inducing apoptosis (Jordan and Wilson 2004). After LncIRF1 overexpression, the proliferation of ALV-J-infected DF1 cells were inhibited. The binding of LncIRF1 to tubulin β possibly disrupted the dynamic balance of tubulin, resulting in inhibited proliferation. The LncIRF1 proteins are mostly enriched in cytoskeletal regulation by the Rho GTPase and integrin signaling pathway. The main effects of cytoskeletal regulation by the Rho GTPase pathway are related to cell proliferation and migration (Kurisu et al. 2005; Noren et al. 2000), and integrin protein is highly expressed in tumor cells (Eble et al. 2006). When LncIRF1 binds to the proteins in these pathways, cell proliferation may be inhibited.
Conclusion
The study demonstrated that LncIRF1 can resist ALV-J infection. Cellular level assays showed that LncIRF1 inhibited the proliferation of ALV-J-infected DF1 cells and increased cellular resistance to ALV-J by increasing the expression levels of IRF1, IRF7, and IFNβ. Moreover, LncIRF1 binding proteins interacted with IRF1, IRF7, and IFNβ. However, our experiments did not show in which way LncIRF1 increased the expression of IRF1, IRF7, and IFNβ, which needs to be explored in subsequent experiments.
Supplementary Information
Below is the link to the electronic supplementary material.
Acknowledgements
This work was supported by the Fundamental Research Funds for the Central Universities (XDJK2020C018), the Postdoctoral Research Foundation of China (208155), the National Natural Science Foundation of China (31802054), and the Project of Chongqing Agricultural Science Innovation (NW202209). This work has also received great support from Southwest University.
Author contributions
All authors have contributed accordingly. LW contributed to experiment design, experiment, data analysis and write. TX contributed to preparation of materials and experiment. ZG contributed to experiment. XZ and GY mainly contributed to data analysis. YH and SJL contributed to revise the article. XL contributed to experiment design, experiment, data analysis and write.
Funding
This work was supported by the Fundamental Research Funds for the Central Universities (XDJK2020C018), the Postdoctoral Research Foundation of China (208155), the National Natural Science Foundation of China (31802054), and the Project of Chongqing Agricultural Science Innovation (NW202209).
Data availability
Accession numbers: SRR11115, SRR18911116.
Declarations
Conflict of interest
On behalf of all authors, the corresponding author states that there is no conflict of interest.
Research involving human participants and/or animals
The study was approved by the Animal Care Committee of Southwest University (Chongqing, China). All animal experiments were performed in accordance with the national guidelines for animal welfare. IACUC NO. Approved: IACUC-20221022-17.
Informed consent
All authors give consent for publication.
References
- Burch TC, Watson MT, Nyalwidhe JO. Variable metastatic potentials correlate with differential plectin and vimentin expression in syngeneic androgen independent prostate cancer cells. PLoS ONE. 2013 doi: 10.1371/journal.pone.0065005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Card CM, Ball TB, Fowke KR. Immune quiescence: a model of protection against HIV infection. Retrovirology. 2013 doi: 10.1186/1742-4690-10-141. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Carnero E, Barriocanal M, Prior C, Pablo Unfried J, Segura V, Guruceaga E, Enguita M, Smerdou C, Gastaminza P, Fortes P. Long noncoding RNA EGOT negatively affects the antiviral response and favors HCV replication. EMBO Rep. 2016;17:1013–1028. doi: 10.15252/embr.201541763. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chai WJ, Li J, Shangguan QL, Liu Q, Li XD, Qi DD, Tong XM, Liu WJ, Ye X. Lnc-ISG20 inhibits influenza A virus replication by enhancing ISG20 expression. J Virol. 2018 doi: 10.1128/jvi.00539-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chen SH, Zhao RH, Wu T, Wang DD, Wang B, Pan SY, Hu XM, Pan ZM, Cui HM. An endogenous retroviral LTR-derived long noncoding RNA lnc-LTR5B interacts with BiP to modulate ALV-J replication in chicken cells. Front Microbiol. 2021 doi: 10.3389/fmicb.2021.788317. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Choi SW, Kim HW, Nam JW. The small peptide world in long noncoding RNAs. Brief Bioinform. 2019;20:1853–1864. doi: 10.1093/bib/bby055. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chung NP, Matthews K, Sanders RW, Moore JP. HIV-1 gp120 impairs the induction of B cell responses by TLR9-activated plasmacytoid dendritic cells. Retrovirology. 2012 doi: 10.1186/1742-4690-9-s2-p9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Eble JA, Jorg H. Integrins in cancer treatment. Curr Cancer Drug Targets. 2006 doi: 10.2174/156800906776056518. [DOI] [PubMed] [Google Scholar]
- Feng M, Dai MM, Xie TT, Li ZH, Shi MQ, Zhang XQ. Innate immune responses in ALV-J infected chicks and chickens with hemangioma in vivo. Front Microbiol. 2016 doi: 10.3389/fmicb.2016.00786. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fujita T, Kimura Y, Miyamoto M, Barsoumian EL, Taniguchi T. Induction of endogenous IFN-α and IFN-β genes by a regulatory transcription factor, IRF-1. Nature. 1989;337:270–272. doi: 10.1038/337270a0. [DOI] [PubMed] [Google Scholar]
- Harris, M. A. 2004. The Gene Ontology (GO) database and informatics resource. The Gene Ontology (GO) database and informatics resource. [DOI] [PMC free article] [PubMed]
- Havel LS, Kline ER, Salgueiro AM, Marcus AI. Vimentin regulates lung cancer cell adhesion through a VAV2-Rac1 pathway to control focal adhesion kinase activity. Oncogene. 2015;34:1979–1990. doi: 10.1038/onc.2014.123. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hu P, Wilhelm J, Gerresheim GK, Shalamova LA, Niepmann M. Lnc-ITM2C-1 and GPR55 are proviral host factors for hepatitis C virus. Viruses-Basel. 2019 doi: 10.3390/v11060549. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jordan MA, Wilson L. Microtubules as a target for anticancer drugs. Nat Rev Cancer. 2004;4:253–265. doi: 10.1038/nrc1317. [DOI] [PubMed] [Google Scholar]
- Kambara H, Niazi F, Kostadinova L, Moonka DK, Siegel CT, Post AB, Carnero E, Barriocanal M, Fortes P, Anthony DD, Valadkhan S. Negative regulation of the interferon response by an interferon-induced long non-coding RNA. Nucleic Acids Res. 2014;42:10668–10680. doi: 10.1093/nar/gku713. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kurisu S, Suetsugu S, Yamazaki D, Yamaguchi H, Takenawa T. Rac-WAVE2 signaling is involved in the invasive and metastatic phenotypes of murine melanoma cells. Oncogene. 2005;24:1309–1319. doi: 10.1038/sj.onc.1208177. [DOI] [PubMed] [Google Scholar]
- Lan X, Wang Y, Tian K, Ye F, Yin H, Zhao X, Xu H, Huang Y, Liu H, Hsieh JCF. Integrated host and viral transcriptome analyses reveal pathology and inflammatory response mechanisms to ALV-J injection in SPF chickens. Sci Rep. 2017 doi: 10.1038/srep46156. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lazear HM, Lancaster A, Wilkins C, Suthar MS, Huang A, Vick SC, Clepper L, Thackray L, Brassil MM, Virgin HW. IRF-3, IRF-5, and IRF-7 coordinately regulate the type I IFN response in myeloid dendritic cells downstream of MAVS signaling. PLoS Pathog. 2013;9:e1003118. doi: 10.1371/journal.ppat.1003118. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lee SB, Taylor JW (1990) PCR protocols: a guide to methods and applications
- Li XJ, Lin WC, Chang S, Zhao P, Zhang XH, Liu Y, Chen WG, Li BH, Shu DM, Zhang HM, Chen F, Xie QM. Isolation, identification and evolution analysis of a novel subgroup of avian leukosis virus isolated from a local Chinese yellow broiler in South China. Adv Virol. 2016;161:2717–2725. doi: 10.1007/s00705-016-2965-x. [DOI] [PubMed] [Google Scholar]
- Liu S, Liu JQ, Yang X, Jiang MH, Wang QQ, Zhang LF, Ma YW, Shen ZY, Tian ZG, Cao XT. Cis-acting lnc-Cxcl2 restrains neutrophil-mediated lung inflammation by inhibiting epithelial cell CXCL2 expression in virus infection. Proc Natl Acad Sci USA. 2021 doi: 10.1073/pnas.2108276118. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Luo H, Hu X, Wu H, Zaib G, Chai G, Cui H (2021) Endogenous Retrovirus-Derived lnc-ALVE1-AS1 Exerts Antiviral Defense Against ALV-J Infection in Chicken Macrophages.
- Matsuyama T. Targeted disruption of IRF-1 or IRF-2 results in abnormal type I IFN gene induction and aberrant lymphocyte development. Cell. 1993;75:83–97. doi: 10.1016/S0092-8674(05)80086-8. [DOI] [PubMed] [Google Scholar]
- Negishi H, Taniguchi T, Yanai H (2017) The Interferon (IFN) Class of Cytokines and the IFN Regulatory Factor (IRF) Transcription Factor Family. Cold Spring Harb Perspect Biol a028423 [DOI] [PMC free article] [PubMed]
- Nogales E. Structural insights into microtubule function. Annu Rev Biophys Biomol Struct. 2001;30:397–420. doi: 10.1146/annurev.biophys.30.1.397. [DOI] [PubMed] [Google Scholar]
- Noren NK, Liu BP, Kreft BB. p120 catenin regulates the actin cytoskeleton via rho family GTPases. J Cell Biol. 2000;150:567–579. doi: 10.1083/jcb.150.3.567. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ogata H, Goto S, Sato K, Fujibuchi W, Kanehisa M. KEGG: kyoto Encyclopedia of Genes and Genomes. Nucleic Acids Res. 1999;27:29–34. doi: 10.1093/nar/27.1.29. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Payne LN, Nair V. The long view: 40 years of avian leukosis research. Avian Pathol. 2012;41:11–19. doi: 10.1080/03079457.2011.646237. [DOI] [PubMed] [Google Scholar]
- Payne LN, Brown SR, Bumstead N, Howes K, Frazier JA, Thouless ME. A novel subgroup of exogenous avian-leukosis virus in chickens. J Gen Virol. 1991;72:801–807. doi: 10.1099/0022-1317-72-4-801. [DOI] [PubMed] [Google Scholar]
- Satelli A, Li SL. Vimentin in cancer and its potential as a molecular target for cancer therapy. Cell Mol Life Sci. 2011;68:3033–3046. doi: 10.1007/s00018-011-0735-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sun Y, Teng Y, Wang L, Zhang Z, Chen C, Wang Y, Zhang X, Xiang P, Song X, Lu J, Li N, Gao L, Liang X, Xia Y, Wu Z, Ma C. LINC01431 promotes histone H4R3 methylation to impede HBV covalently closed circular DNA transcription by stabilizing PRMT1. Adv Sci (weinheim, Baden-Wurttemberg, Germany) 2022;9:e2103135. doi: 10.1002/advs.202103135. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tao L, Li D, Mu S, Tian G, Yan G. LncRNA MAPKAPK5_AS1 facilitates cell proliferation in hepatitis B virus -related hepatocellular carcinoma. Lab Investig J Tech Methods Pathol. 2022;102:494–504. doi: 10.1038/s41374-022-00731-9. [DOI] [PubMed] [Google Scholar]
- Wang Y, Yang FL, Yin HD, He QJ, Lu YX, Zhu Q, Lan X, Zhao XL, Li DY, Liu YP, Xu HY. Chicken interferon regulatory factor 7 (IRF7) can control ALV-J virus infection by triggering type I interferon production through affecting genes related with innate immune signaling pathway. Dev Comp Immunol. 2021 doi: 10.1016/j.dci.2021.104026. [DOI] [PubMed] [Google Scholar]
- Wang X, Li Q, He S, Bai J, Ma C, Zhang L, Guan X, Yuan H, Li Y, Zhu X. LncRNA FENDRR with m6A RNA methylation regulates hypoxia-induced pulmonary artery endothelial cell pyroptosis by mediating DRP1 DNA methylation. Mol Med. 2022;28:126. doi: 10.1186/s10020-022-00551-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wei JW, Huang K, Yang C, Kang CS. Non-coding RNAs as regulators in epigenetics. Oncol Rep. 2017;37:3–9. doi: 10.3892/or.2016.5236. [DOI] [PubMed] [Google Scholar]
- Xing S, Wang J, Wu R, Hefti MM, Crary JF, Lu Y. Identification of HnRNPC as a novel Tau exon 10 splicing factor using RNA antisense purification mass spectrometry. RNA Biol. 2022;19:104–116. doi: 10.1080/15476286.2021.2015175. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Xiong YL, Jia M, Yuan J, Zhang CJ, Zhu Y, Kuang XM, Lan L, Wang XH. STAT3-regulated long non-coding RNAs lnc-7SK and lnc-IGF2-AS promote hepatitis C virus replication. Mol Med Rep. 2015;12:6738–6744. doi: 10.3892/mmr.2015.4278. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhang X, Wang W, Zhu W, Dong J, Cheng Y, Yin Z, Shen F. Mechanisms and functions of long non-coding RNAs at multiple regulatory levels. Int J Mol Sci. 2019;20:5573. doi: 10.3390/ijms20225573. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
Accession numbers: SRR11115, SRR18911116.








