Table 1.
Target virus | Primer set No | Primers | Polarity | Sequence 5ʹ–3ʹ | Bases | Target position on coat protein gene | Position on accession number in NCBI GeneBank (AJ131400.1) | GC (%) | Tm (°C) | Amplicon size (bp) |
---|---|---|---|---|---|---|---|---|---|---|
PVA | A | PVARPAF1 | Sense | CTGAAGGTAAGAAGAAAGAAGGAGAAG | 27 | 37–63 | 8572–8756 | 40.7 | 60.7 | 185a |
PVARPAR1 | Antisense | GTAAGATAGCAAGTGATCTAGGTTAACGAC | 30 | 192–221 | 40 | 61.3 | ||||
B | PVARPAF1 | Sense | CTGAAGGTAAGAAGAAAGAAGGAGAAG | 27 | 37–63 | 8572–8747 | 40.7 | 60.7 | 176 | |
PVARPAR2 | Antisense | CAAGTGATCTAGGTTAACGACACTCTTAC | 29 | 184–212 | 41.4 | 61.7 | ||||
C | PVARPAF2 | Sense | GAAGGTAAGAAGAAAGAAGGAGAAGG | 26 | 39–64 | 8574–8756 | 42.3 | 60.6 | 183 | |
PVARPAR1 | Antisense | GTAAGATAGCAAGTGATCTAGGTTAACGAC | 30 | 192–221 | 40 | 61.3 |
aFor optimization and validation of one-step RT-RPA, the best primer pair was selected