Skip to main content
. 2023 Sep 21;26(10):107986. doi: 10.1016/j.isci.2023.107986
REAGENT or RESOURCE SOURCE IDENTIFIER
Chemicals, peptides, and recombinant proteins

Diethylamine Merck Millipore Cat# 803010
Invitrogen™ PBS Tablets Thermo Fisher Scientific Cat# 003002
Applied Biosystems™ Anode Buffer Container (ABC) Thermo Fisher Scientific Cat# 4393927
Applied Biosystems™ Cathode Buffer Container (CBC) Thermo Fisher Scientific Cat# 4408256
Applied Biosystems™ POP-7™ Polymer for 3500 Thermo Fisher Scientific Cat# 4393708
Invitrogen™ BlueJuice™ Gel Loading Buffer (10X) Thermo Fisher Scientific Cat# 10816105
Invitrogen™ 100 bp DNA Ladder Thermo Fisher Scientific Cat# 15628019
Invitrogen™ SYBR™ Safe DNA Gel Stain Thermo Fisher Scientific Cat# S33102
Invitrogen™ Nuclease-Free Water Thermo Fisher Scientific Cat# AM9937
Agarose, LE, Analytical Grade Promega Cat# V3121
TBE Buffer, 10X, Molecular Biology Grade Promega Cat# V4251
Sigma-Aldrich Ethyl alcohol, Pure Merck Cat# E7023-500ML

Critical commercial assays

GenScreen™ Ultra HIV Ag-Ab Bio-Rad Cat# 72388
QIAamp Viral RNA Mini Kit Qiagen Cat# 52906
Invitrogen™ SuperScript™ III First-Strand Synthesis System Thermo Fisher Scientific Cat# 18080051
Invitrogen™ Platinum™ SuperFi™ DNA Polymerase Thermo Fisher Scientific Cat# 12351010
Applied Biosystems™ ExoSAP-IT™ Express PCR Product Cleanup Reagent Thermo Fisher Scientific Cat# 75001.4X.1.ML
Invitrogen™ SuperScript™ III Reverse Transcriptase Thermo Fisher Scientific Cat# 18080093
Invitrogen™ Ribonuclease H Thermo Fisher Scientific Cat# 18021014
Invitrogen™ dNTP Mix (10 mM ea) Thermo Fisher Scientific Cat# 18427013
Applied Biosystems™ BigDye v3.1 Cycle Sequencing Kit Thermo Fisher Scientific Cat# 4337455
Applied Biosystems™ BigDye XTerminator™ Purification Kit Thermo Fisher Scientific Cat# 4376486

Deposited data

Raw and analyzed data This paper https://data.mendeley.com/datasets/ktg27krty7/1
HIV-1 pol DNA sequence This paper Genbank: OR139650 – OR139679

Oligonucleotides

Primer: PanHIV-1_1F Forward: AGCCYGGGAGCTCTCTG Gall et al.74 N/A
Primer: PanHIV-1_4R Reverse: CTTWTATGCAGCWTCTGAGGG Gall et al.74 N/A
Primer: PanHIV-1_2F Forward: GGGAAGTGAYATAGCWGGAAC Gall et al.74 N/A
Primer: PanHIV-1_2R Reverse: CTGCCATCTGTTTTCCATARTC Gall et al.74 N/A
Primer: KVL84 Reverse: TCCTGTATGCARACCCCAATATG Van Laethem et al.75 N/A
Primer: Rty Reverse: GTGTCTCATTGTTTATACTAGG Yabar et al.76 N/A
Primer: MAW26 Forward: TTGGAAATGTGGAAAGGAAGGAC Yabar et al.76 N/A
Primer: 1243 Reverse: ACTAAGGGAGGGGTATTGACAAACTC Yabar et al.76 N/A
Primer: Rta Forward: GTTGACTCAGATTGGTTGCAC Yabar et al.76 N/A
Primer: Rtb Forward: CCTAGTATAAACAATGAGACAC Yabar et al.76 N/A
Primer: MAW70 Reverse: TAATCCCTGCGTAAATCTGACTTGCCCA Yabar et al.76 N/A

Software and algorithms

Applied Biosystems 3500/3500xL Genetic Analyzer System Thermo Fisher Scientific Cat# 4405673; RRID:SCR_021901
Sequencher v5.4.6 Genecodes, RRID:SCR_001528
GraphPad Prism v9.3.0 GraphPad RRID:SCR_002798
jpHMM (jumping profile Hidden Markov Model) Schultz et al., 200977 http://jphmm.gobics.de/
RIP (Recombinant Identification Program) Siepel et al., 199578 https://www.hiv.lanl.gov/content/sequence/RIP/RIP.html
HIVdb Program: Sequence Analysis Rhee et al., 200379 https://hivdb.stanford.edu/hivdb/by-sequences/