TABLE 2.
Nucleotide sequences used for amplification and/or sequencing reactions
| Primera | Sequence | Positionb | Reference |
|---|---|---|---|
| A2 | 5′-d(GTATCCGCTCATGAGACAAT)-3′ | 148 | This study |
| E | 5′-d(CCAATGCTTAATCAGTGA)-3′ | 1066 | This study |
| C | 5′-d(GGGCAAGAGCAACTCGG)-3′ | 461 | 9 |
| D | 5′-d(CAGCAATGGCAACAACGTTG)-3′ | 753 | 9 |
| F | 5′-d(CAACGTTGTTGCCATTGCTGCAG)-3′ | 772 | This study |
| G | 5′-d(ACCGAGTTGCTCTTGCCC)-3′ | 478 | This study |
a
Primers A2 and E were used for amplification and sequencing. Primers C, D, F, and G were used for sequencing.
b
The numbers correspond to the positions of the first 5′-end base of the oligonucleotide according to the numbering system of Sutcliffe (19).