REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Mouse monoclonal anti HIV-1 p-24 (183-H12-5C)	NIH AIDS Research and Reagent Program	Cat# 1513
Mouse monoclonal anti SIVmac251 gp120 (KK8)	NIH AIDS Research and Reagent Program	Cat# 1403
Mouse monoclonal anti-β Actin antibody (AC-15)	Sigma Aldrich	Cat# A5441; RRID:AB_476744
Goat polyclonal anti HIV-1 gp120	Acris Antibodies	Cat# BP1035
Rat Alexa Fluor 647 anti-mouse IgG1	BioLegend	Cat# 406618; RRID:AB_2563477
HIV-1 broadly neutralizing IgG1 (PGT121)	Laboratory of Dennis Burton	Cat# bNAberID_24 RRID:AB_2491041
anti-Dengue NS1 IgG1 (DEN3)	Laboratory of Dennis Burton	N/A
HIV-1 broadly neutralizing IgG1 (10–1074)	Laboratories of Michel Nussenzweig and Florian Klein	N/A
peroxidase-conjugated F(ab')₂ fragment of goat anti-human IgG	Jackson ImmunoResearch Labs	Cat# 109-036-088, RRID:AB_2337594
Rabbit anti-human IgG antibody, FITC-conjugated	Dako	Cat# F0202, RRID:AB_2335710
Bacterial and virus strains
DH5α E. coli strain, competent	New England Biolabs	Cat# C2987
SIVdup (pseudotyped with SIV Env, HIV Env, gp120+SIV Env, VSV-G)	This paper	N/A
SIVmac239	This paper	N/A
Biological samples
Rhesus monkey PBMCs, plasma, lymphatic tissues	German Primate Center	N/A
Chemicals, peptides, and recombinant proteins
Staphylococcal enterotoxin B (SEB)	Sigma Aldrich	⋅S4881; CAS: 11100-45-1
Staphylococcal enterotoxin A (SEA)	Sigma Aldrich	S9399; CAS: 642595-84-4
HIV-1 ConB gp120	This paper	N/A
Critical commercial assays
QIAamp DNA Mini Kit	Qiagen	Cat#/ID: 51304
QIAamp Viral RNA Mini Kit	Qiagen	Cat#/ID: 52906
Qubit dsDNA HS Assay Kit	Thermo Fisher Scientific	Cat# Q32854
MiSeq Reagent Kit v3	Illumina	MS-102-3003
Bright-Glo™ Luciferase Assay System	Promega	Cat# E2610
NucleoBond® Xtra Maxi EF Kit	Macherey-Nagel	Ref. 740424.10
Agencourt AMPure XP system	Beckman Coulter	Cat# A63881
In-Fusion® HD EcoDry™ Cloning Kit	TaKaRa	Cat# 638912
One Step PrimeScript RT-PCR Kit	TaKaRa	Cat#: RR064B
Deposited data
Next generation sequencing data	This paper	SRA, BioProject: PRJNA958152
Experimental models: Cell lines
HEK-293T/17	ATCC	ATCC® CRL-11268™
CEMx174	NIH AIDS Research and Reagent Program	Cat# 272
CEMxSEAP	(Means et al., 1997)31	N/A
CEM-M7-CCR5	(Brandt et al., 2002)32	N/A
TZMbl	NIH AIDS Research and Reagent Program	Cat# 8129
Experimental models: Organisms/strains
M.mulatta of Indian origin	German Primate Center	N/A
Oligonucleotides
Cloning of SIVdup: envdup500s: GAGGAGGAGATCCGGATTAGAT TTAGGTATTGTGCACCTC	This paper	N/A
Cloning of SIVdup: envdupanti: GAAGGTAACTTCCGGATCTCC TCCTCCAGGA	This paper	N/A
Introduction of genetic tags: dupFlag-s: GTACAGACAACAGA ACCCCATACCNGTNGGNAACA TTTACAGGAGATG	This paper	N/A
Introduction of genetic tags: dupFlag-a: GATCCATCTCCTGT AAATGTTNCCNACNGGTATGG GGTTCTGTTGTCT	This paper	N/A
Primers flanking the genetically tagged region: NGS-2dupGag-s: TCGTCGGC AGCGTCAGATGTGTATAAGAG ACAGCAACCAGCTCCACAACAAGG	This paper	N/A
Primers flanking the genetically tagged region: NGS-2dupGag-a: GTCTCGTGGG CTCGGAGATGTGTATAAGAGACA GCTGTCTACATAGCTCTGAAATGGC	This paper	N/A
Viral quantification: gag forward primer: ACCCAGTACAACAAATAGGTGGTAACT	Sigma-Aldrich	N/A
Viral quantification: gag reverse primer: TCAATTTTACCCAGGCATTTAATGT	Sigma-Aldrich	N/A
Viral quantification: gag probe: 5′-6FAM-TGTCCACCTGCCATTAA GCCCGAG-TAMRA-3′	Sigma-Aldrich	N/A
Recombinant DNA
pBRmac239	(Schnell et al., 2000)33	N/A
SIVdupAAC, SIVdupTAG, SIVdupCCT expression constructs	This paper	N/A
pCAGGS-SF162P3Nc8	C. Cheng-Mayer (Ho et al., 2007)16	N/A
pcdSenv251co	This paper	N/A
gp120-162P3N-GTM/CD	This paper	N/A
pHIT-G	(Fouchier et al., 1997)34	N/A
pΔenv-GFP	(Schnell et al., 2000)33	N/A
pcD-HIVgp120ΔKR-His	(Storcksdieck genannt Bonsmann, 2014)35	N/A
Software and algorithms
FlowJo Analysis Software	TreeStar	https://www.flowjo.com/solutions/flowjo/downloads
GraphPad Prism 5.00 for Windows	GraphPad Software, Inc.	https://www.graphpad.com/scientific-software/prism/
QIAGEN CLC Genomics Workbench 9	Qiagen Aarhus	https://digitalinsights.qiagen.com/products-overview/discovery-insights-portfolio/analysis-and-visualization/qiagen-clc-genomics-workbench