KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Anti-VSV-G epitope antibody | Sigma | Cat# V4888 |
| Anti-H3 antibody | Cell Signaling Technology | Cat# 4499 |
| Anti-H2B antibody | Cell Signaling Technology | Cat# 2934 |
| Anti-FLAG M2-HRP | Sigma | Cat# A8592 |
| Anti-RAD51 | Cell Signaling Technology | Cat# 18875 |
| Anti-RPA34 | Sigma | Cat# MABE285 |
| Anti-His-HRP | Sigma | Cat# A7058 |
| Anti-GAPDH | Cell Signaling Technology | Cat# 2118S |
| Anti-β-Tubulin | Cell Signaling Technology | Cat# 2128S |
| Anti-HA | Cell Signaling Technology | Cat# 3724S |
| Anti-BRCA1 | Santa Cruz Biotech | Cat# SC6954 |
| Anti-BARD1 | Abcam | Cat# ab50984 |
| Anti-Lamin B1 | Santa Cruz Biotech | Cat# SC374015 |
| Anti-53BP1 | Sigma | Cat# MAB3802 |
| Anti-Actin | Abcam | Cat# ab3280 |
| Anti-γH2AX | Sigma | Cat# 05636 |
| Anti-©H2AX | Cell Signaling Technology | at# 9718S |
| Anti-CtIP | Active Motif | Cat# 61141; RRID: AB_2714164 |
| Anti-BrdU | BD Biosciences | Cat# 347580; RRID: AB_400326 |
| Anti-CtIP | Invitrogen | Cat# PA5–84133; RRID: AB_2791285 |
| Chemicals, peptides, and recombinant proteins | ||
| Olaparib | Selleckchem | Cat#HY-10162; CAS: 763113–22-0 |
| Camptothecin | Sigma | Cat#208925; CAS: 7689–03-4 |
| Cisplatin | Selleckchem | Cat#P4394; CAS: 15663–27-1 |
| Mitomycin C | Sigma | Cat#HY-13316; CAS: 50–07-7 |
| Doxycycline | Sigma | Cat# D3447 |
| BRCA1-BARD1 (WT or mutants) | In this study | N/A |
| BRCA1 fragments (BRCA1200–500, BRCA1500–894, and BRCA1936–1316) | In this study | N/A |
| BARD1 fragments (BARD1124–270, BARD1216–425, and BARD1425–565 | In this study | N/A |
| 15N-labeled UBE2D3 | In this study | N/A |
| 15N-labeled BRCA11–112-BARD26–142 | In this study | N/A |
| E1 (UBA1) | In this study | N/A |
| E2s (UBE2D3, UBE2W, UBE2E3, UBE2E2, UBE2E1, UBE2N, UBE2V2, UBE2B) | In this study | N/A |
| Ubiquitin | In this study | N/A |
| RING1B1–159/BMI11–109 | In this study | N/A |
| Histone octamer | In this study | N/A |
| phosphorylated CtIP | In this study | N/A |
| RAD51 | In this study | N/A |
| AlexaFluor488-Ubiquitin | In this study | N/A |
| AlexaFluor594-UBE2D3 | In this study | N/A |
| Critical commercial assays | ||
| Duolink PLA kit | Sigma | Cat# DUO92101 |
| Q5 Site-Directed Mutagenesis Kit | New England BioLabs | Cat# E0554 |
| Mammalian β-Galactosidase Kit | Thermo Fisher Scientific | Cat# T1029 |
| Deposited data | ||
| Original images and blots | This manuscript | Mendeley data: doi:10.17632/9s37k6s8jr.1 |
| Experimental models: Cell lines | ||
| HeLa | ATCC | CCL-2 |
| U2OS (DR, SA, EJ5) | Jeremy Stark Lab | N/A |
| MDA-MB-436 | Bing Xia Lab | N/A |
| Oligonucleotides | ||
| Control siRNA (UAGCCGGUAGACUUAGGUCUG), | Qiagen | N/A |
| BRCA1 siRNA (AAGCUCCUCUCACUCUUCAGU) | Qiagen | N/A |
| TP53BP1 siRNA | Thermo Fisher Scientific | Cat# s14313 |
| Recombinant DNA | ||
| pFB-BRCA1 | In this study | N/A |
| pFB-BRCA1 I26A | In this study | N/A |
| pFB-BRCA1 E3d | In this study | N/A |
| pFB-BRCA1 R71G | In this study | N/A |
| pFB-BARD1 | In this study | N/A |
| pFB-BARD1-P89A/W91A | In this study | N/A |
| pcDNA5/FRT-BRCA1 | In this study | N/A |
| pcDNA5/FRT-BRCA1 I26A | In this study | N/A |
| pcDNA5/FRT-BRCA1 E3d | In this study | N/A |
| pcDNA5/FRT-BRCA1 C61G | In this study | N/A |
| pcDNA5/FRT-BARD1 | In this study | N/A |
| pcDNA5/FRT-BARD1 P89A/W91A | In this study | N/A |
| pTRIP-Puro-P2A-BRCA1 | In this study | N/A |
| pTRIP-Puro-P2A-BRCA1 I26A | In this study | N/A |
| pTRIP-Puro-P2A-BRCA1 E3d | In this study | N/A |
| pTRIP-Blasticidin-P2A-BARD1 | In this study | N/A |
| Software and algorithms | ||
| GraphPad Prism 9 | Graphpad | https://www.graphpad.com/ |
| Image J | National Institutes of Health | https://imagej.nih.gov/ij/ |
| Image lab | Bio-Rad | https://www.bio-rad.com |
| Celleste 5 image analysis | Invitrogen | https://www.thermofisher.com/ |
| Casplab software | Casplab | https://www.casplab.com/ |
| Matlab | MathWorks | https://www.mathworks.com/ |
| FlowJo software | FlowJo | https://www.Flowjo.com |
| Adobe Illustrator 2020 | Adobe | https://www.adobe.com |
| Adobe Photoshop 2023 | Adobe | https://www.adobe.com |