MMD collaborates with ACSL4 and MBOAT7 to promote polyunsaturated phosphatidylinositol remodeling and susceptibility to ferroptosis

. Author manuscript; available in PMC: 2023 Oct 23.

Published in final edited form as: Cell Rep. 2023 Sep 8;42(9):113023. doi: 10.1016/j.celrep.2023.113023

KEY RESOURCES TABLE

REAGENT or RESOURCE	SOURCE	IDENTIFIER

Antibodies

Rabbit monoclonal anti-HA	Cell Signaling Technology	Cat#3724; RRID: AB_1549585
Rabbit polyclonal anti-MMD	Cell Signaling Technology	N/A
Rabbit monoclonal anti-MMD	Cell Signaling Technology	Cat#20226
Rabbit polyclonal anti-FSP1	Cell Signaling Technology	Cat#24972S
Rabbit polyclonal anti-ACSL4	Invitrogen	Cat#PA527137; RRID: AB_2544613
Rabbit monoclonal anti-GPX4	abcam	Cat#ab125066; RRID: AB_10973901
Rat monoclonal anti-MBOAT7	Dr. Nozomu Kono (The University of Tokyo, Tokyo, Japan); Lee et al.⁴¹	N/A
Mouse monoclonal anti-COXIV	Cell Signaling Technology	Cat#11967; RRID: AB_2797784
Rabbit monoclonal anti-GAPDH	Cell Signaling Technology	Cat#2118; RRID: AB_561053
Mouse monoclonal anti-CANX	Invitrogen	Cat#MA3–027; RRID: AB_2069043
Mouse monoclonal anti-HA-Tag Alexa Fluor 647 Conjugate	Cell Signaling Technology	Cat#3444S; RRID: AB_10693329
Rabbit monoclonal anti-GM130	Cell Signaling Technology	Cat#12480; RRID: AB_2797933
Rabbit monoclonal Anti-DYKDDDDK (FLAG)	Cell Signaling Technology	Cat#14793S; RRID: AB_2572291

Bacterial and virus strains

One Shot™ MAX Efficiency™ DH5α-T1R competent cells	Invitrogen	12297016

Biological samples

Discarded human blood products	Crimson Core Specimen Bank (Brigham & Women’s Hospital, Boston, MA, USA)	https://crimson-core.partners.org/samples/

Chemicals, peptides, and recombinant proteins

RSL3	SelleckChem	Cat#S8155
ML210	Sigma-Aldrich	Cat#SML0521
Erastin	SelleckChem	Cat#S7242
FIN56	SelleckChem	Cat#S8254
Ferrostatin-1	Sigma-Aldrich	Cat#SML0583
Z-VAD-FMK	SelleckChem	Cat#S7023
Necrostatin-1	SelleckChem	Cat#S8037
BSA-control	Cayman Chemical	Cat#29556
BSA-palmitate	Cayman Chemical	Cat#29558
PMA	Sigma-Aldrich	Cat#P8139
Recombinant human M-CSF	Peprotech	Cat#300–25
³H-Arachidonic acid	Perkin Elmer	Cat#NET298Z050UC

Critical commercial assays

CellTiter-Glo^® Luminescent Cell Viability Assay	Promega	Cat#G7571
BODIPY™ 581/591 C11 (Lipid Peroxidation Sensor)	Invitrogen	Cat#D3861

Deposited data

Lipidomics dataset #1 (OVCAR-8 and 786-O NT sg vs. MMD KO cells) and associated code	This paper; Zenodo	Zenodo: https://doi.org/10.5281/zenodo.8169857
Lipidomics dataset #3 (OVCAR-8 NT sg, MMD KO, EV + NT sg, and EV + MBOAT7 sg cells) and associated code	This paper; Zenodo	Zenodo: https://doi.org/10.5281/zenodo.8169908
Lipidomics dataset #4 (OVCAR-8 NT sg, MMD2 sg bulk, MMD2 KO1, MMD2 KO2, NT sg + NT sg, NT sg + MBOAT7 sg, MMD KO + NT sg, and MMD KO + MBOAT7 sg cells) and associated code	This paper; Zenodo	Zenodo: https://doi.org/10.5281/zenodo.8169917
Polar metabolomics dataset (OVCAR-8 and 786-O NT sg vs. MMD KO cells)	This paper; Zenodo	Zenodo: https://doi.org/10.5281/zenodo.8169924
Code for calculating all ranked codependencies of MMD, ACSL4, and MBOAT7 in DepMap	This paper; Zenodo	Zenodo: https://doi.org/10.5281/zenodo.8169937
All raw mass spectrometry (metabolomics) data	This paper; Metabolights	Metabolights: MTBLS8280

Experimental models: Cell lines

OVCAR-8 parental	Dr. Joan Brugge (Harvard Medical School, Boston, MA, USA)	RRID: CVCL_1629
OVCAR-8 NT sg (puro)	This paper	N/A
OVCAR-8 NT sg (blast)	This paper	N/A
OVCAR-8 MMD KO (puro)	This paper	N/A
OVCAR-8 MMD KO + [pLV-EF1a-IRES-blast] EV	This paper	N/A
OVCAR-8 MMD KO + [pLV-EF1a-IRES-blast] MMD (HA-MMD)	This paper	N/A
OVCAR-8 [pLJM1] EV	This paper	N/A
OVCAR-8 [pLJM1] MMD OE (a.k.a. MMD, HA-MMD)	This paper	N/A
OVCAR-8 HA-MMD + [pRH115] FLAG-MBOAT7	This paper	N/A
OVCAR-8 MMD2 sg1 (puro)	This paper	N/A
OVCAR-8 MMD2 KO1 (puro)	This paper	N/A
OVCAR-8 MMD2 KO2 (puro)	This paper	N/A
OVCAR-8 ACSL4 sg (blast)	This paper	N/A
OVCAR-8 [pLJM1] EV + NT sg (blast)	This paper	N/A
OVCAR-8 [pLJM1] EV + ACSL4 sg (blast)	This paper	N/A
OVCAR-8 MMD + NT sg (blast)	This paper	N/A
OVCAR-8 MMD + ACSL4 sg (blast)	This paper	N/A
OVCAR8 [pLJM1] EV + MBOAT7 sg (blast)	This paper	N/A
OVCAR-8 MMD + MBOAT7 sg (blast)	This paper	N/A
OVCAR-8 [pLJM1] EV + LPCAT3 sg (blast)	This paper	N/A
OVCAR-8 MMD + LPCAT3 sg (blast)	This paper	N/A
OVCAR-8 MMD KO + [pLV-mCherry] ACSL4-HA	This paper	N/A
OVCAR-8 MMD KO + [pLV-mCherry] FLAG-MBOAT7	This paper	N/A
OVCAR-8 MMD KO + [pLV-mCherry] ACSL4-HA-P2A-FLAG-MBOAT7	This paper	N/A
OVCAR-8 NT sg (puro) + NT sg (blast)	This paper	N/A
OVCAR-8 NT sg (puro) + MBOAT7 sg (blast)	This paper	N/A
OVCAR-8 MMD KO (puro) + NT sg (blast)	This paper	N/A
OVCAR-8 MMD KO (puro) + MBOAT7 sg (blast)	This paper	N/A
786-O parental	Broad Institute Biological Samples Platform (Broad Institute, Cambridge, MA, USA)	RRID: CVCL_1051
786-O NT sg (blast)	This paper	N/A
786-O MMD KO (blast)	This paper	N/A
786-O [pLJM1] MMD OE (puro)	This paper	N/A
786-O MBOAT7 sg (blast)	This paper	N/A
Huh7 WT	Dr. J. Mark Brown (Cleveland Clinic, Cleveland, OH, USA); Helsley et al.⁶⁸	N/A
Huh7 MBOAT7 KO	Dr. J. Mark Brown (Cleveland Clinic, Cleveland, OH, USA); Helsley et al.⁶⁸	N/A
HT-1080 parental	Dr. Robert A. Weinberg (Whitehead Institute for Biomedical Research, Cambridge, MA, USA)	RRID: CVCL_0317
HT-1080 NT sg (blast)	This paper	N/A
HT-1080 MBOAT7 sg (blast)	This paper	N/A
THP-1	Dr. Jaime Cheah (Koch Institute for Integrative Cancer Research, Cambridge, MA, USA)	RRID: CVCL_0006
HEK293T	ATCC	Cat#CRL-3216; RRID: CVCL_0063
OVCAR-8 parental MaMTH Gaussia princeps luciferase reporter line (B0755)	This paper	N/A
OVCAR-8 NT sg MaMTH Gaussia princeps luciferase reporter line (B0781)	This paper	N/A
OVCAR-8 MMD KO MaMTH Gaussia princeps luciferase reporter line (B0772)	This paper	N/A
HEK293	Thermo-Fisher	Cat#R78007; RRID: CVCL_0045
HEK293 MaMTH Gaussia princeps luciferase reporter line	Dr. Igor Stagljar (University of Toronto, Toronto, Canada); Saraon et al.⁴⁹	N/A

Oligonucleotides

MMD qPCR primer (Fwd, 5’→3′): CCGCTACAAGCCAACTTGCTAT	This paper	N/A
MMD qPCR primer (Rev, 5’→3′): AGTCCCATTCCATAAATCCATG	This paper	N/A
ACTB qPCR primer (Fwd, 5’→3′): CACCATTGGCAATGAGCGGTTC	This paper	N/A
ACTB qPCR primer (Rev, 5’→3′): AGGTCTTTGCGGATGTCCACGT	This paper	N/A
sgRNA target sequences, see Table S2	This paper	N/A
CRISPR Sanger sequencing primers, see Table S2	This paper	N/A
MaMTH plasmid cloning primers, see Table S3	This paper	N/A
MaMTH plasmid sequencing primers, see Table S3	This paper	N/A

Recombinant DNA

Vector for CRISPR cloning: lentiCRISPRv2-puro	Dr. Feng Zhang (Broad Institute, Cambridge, MA, USA); Sanjana et al.⁶⁹	Addgene #52961; RRID: Addgene_52961
Vector for CRISPR cloning: lentiCRISPRv2-blast	Dr. Mohan Babu (University of Regina, Regina, Canada)	Addgene #83480; RRID: Addgene_83480
Vector for cDNA expression: pLJM1	Dr. Joshua Mendell (UT Southwestern, Dallas, TX, USA); Golden et al.⁷⁰	Addgene #91980; RRID: Addgene_91980
Vector for cDNA expression: pLV-EF1a-IRES-blast	Dr. Tobias Meyer (Stanford University School of Medicine, Stanford, CA, USA); Hayer et al.⁷¹	Addgene #85133; RRID: Addgene_85133
Vector for FLAG-MBOAT7 cloning: pRH115	Dr. Tobiloba Oni (Whitehead Institute for Biomedical Research, Cambridge, MA, USA)	N/A
MMD cDNA	Horizon Discovery Mammalian Gene Collection	Cat#BC026324
MBOAT7 cDNA	Horizon Discovery Mammalian Gene Collection	Cat#BC003164
memACSL4 cDNA	GenScript	Cat#OHu23492, transcript variant 2, mRNA
pLV-mCherry-EF1a-memACSL4-HA	VectorBuilder, custom made for this paper	N/A
pLV-mCherry-EF1a-FLAG-MBOAT7	VectorBuilder, custom made for this paper	N/A
pLV-mCherry-EF1a-memACSL4-HA:P2A:FLAG-MBOAT7	VectorBuilder, custom made for this paper	N/A
lentiCRISPRv2-puro_NT sg	This paper	N/A
lentiCRISPRv2-blast_NT sg	This paper	N/A
lentiCRISPRv2-puro_MMDsg10	This paper	N/A
lentiCRISPRv2-blast_MMDsg8	This paper	N/A
lentiCRISPRv2-puro_MMD2sg1	This paper	N/A
lentiCRISPRv2-blast_ACSL4sg	This paper	N/A
lentiCRISPRv2-blast_MBOAT7sg3	This paper	N/A
lentiCRISPRv2-blast_LPCAT3sg3	This paper	N/A
pLV-EF1a-IRES-blast_HA-MMD_sgResistant	This paper	N/A
pLJM1_HA-MMD	This paper	N/A
pRH115_FLAG-MBOAT7	This paper	N/A
Gateway cloning entry vector: pDONR221	Dr. Tsukasa Shibue (Broad Institute, Cambridge, MA, USA)	N/A
MaMTH N-terminally tagged MMD prey: A1245 MMD	This paper	N/A
MaMTH C-terminally tagged memACSL4 prey: A1379 memACSL4	This paper	N/A
MaMTH C-terminally tagged MBOAT7 bait: A1160 MBOAT7	This paper	N/A
MaMTH C-terminally tagged memACSL4 bait: A1160 memACSL4	This paper	N/A
MaMTH N-terminally tagged PEX7 prey: A1245 PEX7	Dr. Igor Stagljar (University of Toronto, Toronto, Canada); Saraon et al.⁵⁰	N/A
MaMTH 5xGAL4 UAS Gaussia princeps reporter plasmid containing hygromycin resistance cassette (A1687)	This paper	N/A

Software and algorithms

ApE Version 3.1.3	Davis et al.⁷²	https://jorgensen.biology.utah.edu/wayned/ape/
SnapGene Version 6.2.1	Dotmatics	www.snapgene.com
GraphPad Prism Version 9.5.1	Dotmatics	www.graphpad.com
RStudio Version 2022.07.0 + 548	RStudio Team⁷³	www.rstudio.com
R Version 4.2.1	R Core Team⁷⁴	https://www.R-project.org
ICE Analysis Tool Version 3.0	Synthego	https://ice.synthego.com/#/
Imaris Version 10.0	Oxford Instruments	https://imaris.oxinst.com/
LipidSearch Version 4.2.27	Thermo Fisher Scientific, Mitsui Knowledge Industries^75,76	N/A
TraceFinder	Thermo Fisher Scientific	N/A
Progenesis QI	Nonlinear Dynamics	https://www.nonlinear.com/progenesis/qi/