KEY RESOURCES TABLE.
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| H3K27ac | Active Motif | Cat# 39133; RRID: AB_2561016 |
| H3 | Active Motif | Cat# 39163; RRID: AB_2614978 |
| NCoR | Gifted from Dr. Hamakubo | Cat# IgG-Y8129; RRID: N/A |
| SMRT | Novus | Cat# NB100-58826; RRID: AB_877767 |
| HDAC3 | GeneTex | Cat# GTX113303; RRID: AB_10721050 |
| PU.1 | Santa Cruz | Cat# sc-352; RRID: AB_632289 |
| p65 | Santa Cruz | Cat# sc-372; RRID: AB_632037 |
| p50 | Santa Cruz | Cat# sc-1190; RRID: AB_632033 |
| Fosl2 | Santa Cruz | Cat# sc-166102; RRID: AB_2107079 |
| PGC1β | Abcam | Cat# ab176328; RRID: N/A |
| Acetylated-Lysine | Cell Signaling Technology | Cat# 9441; RRID: AB_331805 |
| ACP5 | Millipore | Cat# MABF96; RRID: AB_10845145 |
| TAB2 | Proteintech | Cat# 14410-1-AP; RRID: AB_2281638 |
| TBL1 | Santa Cruz | Cat# sc-137006; RRID: AB_ 2199796 |
| FLAG | Sigma-Aldrich | Cat# F1804; RRID: AB_262044 |
| HA | Abcam | Cat# ab9110; RRID: AB_307019 |
| Lamin B | Santa Cruz | Cat# sc-374015; RRID: AB_10947408 |
| Lamin A/C | Cell Signaling Technology | Cat# 2032; RRID: AB_2136278 |
| β-Actin | Sigma-Aldrich | Cat# A2228; RRID: AB_476697 |
| Polyclonal Goat Anti-Mouse Immunoglobulins-HRP | Dako | Cat# P0447; RRID: AB_2617137 |
| Polyclonal Goat Anti-Rabbit Immunoglobulins-HRP | Dako | Cat# P0448; RRID: AB_2617138 |
| Mouse monoclonal anti-rabbit IgG light chain-HRP | Abcam | Cat# ab99697; RRID: AB_10673897 |
| Bacterial and Virus Strains | ||
| Ad-RFP | Vector Biolabs | Cat# 1660 |
| Ad-CMV-iCre | Vector Biolabs | Cat# 1045 |
| Biological Samples | ||
| N/A | ||
| Chemicals, Peptides, and Recombinant Proteins | ||
| PMI 1640 | Corning | Cat# 10-014-CV |
| alpha MEM | Sigma-Aldrich | Cat# M8042 |
| Opti-MEM | Thermo Fisher Scientific | Cat# 11058021 |
| FBS | Omega Biosciences | Cat# FB-02 |
| Penicillin/streptomycin + L-glutamine | Thermo Fisher Scientific | Cat# 10378016 |
| eBioscience™ 1X RBC Lysis Buffer | Invitrogen | Cat# 00-4333-57 |
| Polybrene | Sigma-Aldrich | Cat# H9268 |
| Lipofectamine™ RNAiMAX Transfection Reagent | Invitrogen | Cat# 13778075 |
| Lipofectamine™ LTX Reagent with PLUS™ Reagent | Invitrogen | Cat# 15338030 |
| X-tremeGENE™ HP DNA Transfection Reagent | Roche | Cat# 6366546001 |
| Mouse M-CSF | Shenandoah Biotechnology | Cat# 200-08 |
| β-estradiol | Sigma-Aldrich | Cat# E2758 |
| GM-CSF | PeproTech | Cat# 315-03 |
| RGFP966 | Selleckchem | Cat# S7229 |
| KLA | Avanti Polar Lipids | Cat# 699500P |
| RANKL | PeproTech | Cat# 315-11 |
| SCF | PeproTech | Cat# 250-03 |
| IL3 | PeproTech | Cat# 213-13 |
| IL6 | PeproTech | Cat# 216-16 |
| Ficoll-Paque-Plus | Sigma-Aldrich | Cat# GE17-1440-02 |
| LentiBlast™ Transduction Reagent | OZ Biosciences | Cat# LB00500 |
| Fibronectin | Sigma-Aldrich | Cat#F0895 |
| G418 | Thermo Fisher Scientific | Cat# 10131035 |
| Poly-D-lysin | Sigma-Aldrich | Cat# DLW354210 |
| KOD Xtreme™ Hot Start DNA Polymerase | Millipore | Cat# 71975 |
| NuPAGE™ LDS Sample Buffer | Thermo Fisher Scientific | Cat# NP0007 |
| NuPAGE™ Sample Reducing Agent | Thermo Fisher Scientific | Cat# NP0009 |
| SuperSignal™ West Femto Maximum Sensitivity Substrate | Thermo Fisher Scientific | Cat #34095 |
| Luminate™ Forte Western HRP Substrate | Merck Millipore | Cat# WBLUF0100 |
| Dynabeads Protein A | Thermo Fisher Scientific | Cat# 10002D |
| Dynabeads Protein G | Thermo Fisher Scientific | Cat# 10004D |
| SpeedBeads magnetic carboxylate modified particles | GE Healthcare | Cat# 65152105050250 |
| Dynabeads My One Silane | Thermo Fisher Scientific | Cat# 37002D |
| TRIzol Reagent | Thermo Fisher Scientific | Cat# 15596018 |
| Formaldehyde | Thermo Fisher Scientific | Cat# BP531-500 |
| Disuccinimidyl glutarate | ProteoChem | Cat# c1104-100mg |
| Proteinase K | NEB | Cat# P8107S |
| Oligo d(T)25 Magnetic Beads | NEB | Cat# S1419S |
| DTT | Thermo Fisher Scientific | Cat# P2325 |
| SUPERase-In | Ambion | Cat# AM2696 |
| RNase Inhibitor | NEB | Cat# M0314S |
| FastAP | Thermo Fisher Scientific | Cat# EF0651 |
| Oligo dT primer | Thermo Fisher Scientific | Cat# 18418020 |
| RNA Clean XP Beads | Beckman Coulter | Cat# A63987 |
| 10 X Blue Buffer | Enzymatics | Cat# P7050L |
| dNTP mix | Thermo Fisher Scientific | Cat# R0191 |
| RNase A | NEB | Cat# T3018L |
| RNase H | Enzymatics | Cat# Y9220L |
| RNase I | Thermo Fisher Scientific | Cat# AM2295 |
| DNase I | NEB | Cat# M0303S |
| Turbo DNase | Thermo Fisher Scientific | Cat# AM2238 |
| DNA polymerase I | Enzymatics | Cat# P7050L |
| T4 PNK | NEB | Cat# M0201S |
| T4 RNA ligase | NEB | Cat# M0204S |
| NEXTflex® DNA Barcodes | Bioo Scientific | Cat# NOVA-514104 |
| Random primers | Thermo Fisher Scientific | Cat# 48190011 |
| SuperScript III Reverse Transcriptase | Thermo Fisher Scientific | Cat# 18080044 |
| 5X SuperScript III first-strand buffer | Thermo Fisher Scientific | Cat# 18080044 |
| Actinomycin D | Sigma-Aldrich | Cat# A1410 |
| NEBNext High-Fidelity 2X PCR Master Mix | NEB | Cat# M0541S |
| KAPA SYBR FAST qPCR Master Mix | Kapa Biosystems | Cat# KR0389 |
| Exo SAP-IT | Applied Biosystems | Cat# 78201.1.ML |
| PMSF | Sigma-Aldrich | Cat# P7626 |
| Protease inhibitor cocktail | Sigma-Aldrich | Cat# P8340 |
| Sodium butylate | Sigma-Aldrich | Cat# B5887 |
| Recombinant Mononucleosomes H3K27ac | Active Motif | Cat# 81077 |
| Phenol/chloroform/isoamyl alcohol (125:24:1) | Sigma-Aldrich | Cat# P1944 |
| Critical Commercial Assays | ||
| HAT Assay Kit | Active Motif | Cat# 56100 |
| Direct-zol RNA MicroPrep Kit | Zymo Research | Cat# R2062 |
| ChIP DNA Clean & Concentrator Kit | Zymo Research | Cat# D5205 |
| NEBNext Ultra II Library Preparation Kit | NEB | Cat# E7645L |
| Nextera DNA Library Prep Kit | Illumina | Cat# 15028212 |
| Qubit dsDNA HS Assay Kit | Invitrogen | Cat# Q32851 |
| KAPA HiFi HotStart PCR Kit | Kapa Biosystems | Cat# KK2501 |
| Mouse Deoxypyridinoline ELISA Kit | LSBio | Cat# LS-F25774-1 |
| Mouse Osteocalcin EIA Kit | Alfa Aesar | Cat# 15406279 |
| OsteoLyse™ Assay Kit | Lonza | Cat# PA-1500 |
| TRAP Staining Kit | Cosmo Bio | Cat# PMC-AK04F |
| Q5 Site-Directed Mutagenesis Kit | NEB | Cat# E0554S |
| DC™ Protein Assay Kit | Bio-Rad Laboratories | Cat# 5000112 |
| NucleoSpin Tissue kits | Macherey-Nagel | Cat# 740952 |
| NucleoSpin Gel and PCR Clean-Up kits | Macherey-Nagel | Cat# 740609 |
| Deposited Data | ||
| UCSC hub of all sequencing data | This paper | GEO: GSE211676 |
| Experimental Models: Cell Lines | ||
| Lenti-X 293T cell | Clontech | Cat# 632180 |
| RAW 264.7 cell | ATCC | Cat# TIB-71; RRID: CVCL_0493 |
| Experimental Models: Organisms/Strains | ||
| Mouse: Ncorflox/flox | Li et al., 2013 | N/A |
| Mouse: Smrtflox/flox | Lee et al., 2022 | N/A |
| Mouse: Ncorflox/flox Smrtflox/flox | This paper | N/A |
| Mouse: Pgc1bflox/flox | Sonoda et al., 2007 | N/A |
| Mouse: B6.129P2-Lyz2tm1(cre)Ifo/J | The Jackson Laboratory | Cat# 004781 |
| Mouse: B6(C)-Gt(ROSA)26Sorem1.1(CAG-cas9*,-EGFP)Rsky/J | The Jackson Laboratory | Cat# 028555 |
| Oligonucleotides | ||
| Mouse Dancr siRNA (individual #1), See METHOD DETALS | Dharmacon | Customized |
| Mouse Dancr siRNA (individual #2), See METHOD DETALS | Dharmacon | Customized |
| Mouse Rnu12 siRNA (individual #1), See METHOD DETALS | Dharmacon | Customized |
| Mouse Rnu12 siRNA (individual #2), See METHOD DETALS | Dharmacon | Customized |
| siGENOME Non-Targeting siRNA #2 | Dharmacon | Cat# D-001210-02 |
| Mouse PGC1β_1 gRNA GGAAGAGCTCGGAGTCATCG |
This paper | N/A |
| Mouse PGC1β_2 gRNA AGCGTCTGACGTGGACGAGC |
This paper | N/A |
| Mouse Control gRNA GCACTACCAGAGCTAACTCA |
This paper | N/A |
| Recombinant DNA | ||
| lentiGuide-puro | Addgene | Cat# 52963 |
| psPAX2 | Addgene | Cat# 12260 |
| pVSVG | Addgene | Cat# 138479 |
| pLIX403-APOBEC-HA-P2A-mRuby | Brannan et al., 2021 | N/A |
| pcDNA3.1-FLAG-mouse PGC1β | NovoPro Bioscience | Cat# 759974-2 |
| Software and Algorithms | ||
| Bowtie2 | Langmead and Salzberg, 2012 | http://bowtie-bio.sourceforge.net/bowtie2/ |
| HOMER | Heinz et al., 2010 | http://homer.ucsd.edu/homer/ |
| Irreproducibility Discovery Rate (IDR) | Li et al., 2011 | https://www.encodeproject.org/software/idr/ |
| Metascape | Tripathi et al., 2015 | http://metascape.org/gp/index.html#/main/step1 |
| R package: DeSeq2 | Love et al., 2014 | https://bioconductor.org/packages/release/bioc/html/DESeq2.html |
| STAR | Dobin et al., 2013 | https://github.com/alexdobin/STAR |
| UCSC Genome Browser | Kent et al., 2002 | https://genome.ucsc.edu/ |
| GraphPad Prism 8 software | Dotmatics | https://www.graphpad.com/ |
| Other | ||
| N/A | ||