Mpox Infection Protects Against Re-Challenge in Rhesus Macaques

SUMMARY

The mpox outbreak of 2022–2023 involved rapid global spread in men who have sex with men. We infected 18 rhesus macaques with mpox by the intravenous, intradermal, and intrarectal routes and observed robust antibody and T cell responses following all three routes of infection. Numerous skin lesions and high plasma viral loads were observed following intravenous and intradermal infection. Skin lesions peaked on day 10 and resolved by day 28 following infection. On day 28, we re-challenged all convalescent and 3 naïve animals with mpox. All convalescent animals were protected against re-challenge. Transcriptomic studies showed upregulation of innate and inflammatory responses and downregulation of collagen formation and extracellular matrix organization following challenge, as well as rapid activation of T cell and plasma cell responses following re-challenge. These data suggest key mechanistic insights into mpox pathogenesis and immunity. This macaque model should prove useful for evaluating mpox vaccines and therapeutics.

Graphical Abstract

Modeling mpox infection in rhesus macaques demonstrates the protective efficacy of natural immunity induced by three routes of viral exposure against re-challenge.

The explosive mpox outbreak in 2022–2023 resulted in over 80,000 cases in 110 countries worldwide, including approximately 30,000 cases in the United States, and was designated a Public Health Emergency of Internal Concern (PHEIC) by the World Health Organization. This outbreak differed markedly from prior mpox outbreaks in terms of its global scale, rapid spread, unique clinical features, and epidemiology primarily in men who have sex with men (MSM)^1,2. The outbreak strain has been determined to be the West African B.1 lineage clade 2b mpox and is believed to spread primarily in sexual networks, possibly by both skin-to-skin contact and sexual contact³.

Our understanding of mpox pathogenesis and immunity in the context of the current outbreak is limited. In particular, it is not known whether mpox infection by non-traditional routes of infection, reflective of spread in MSM populations, induces natural immunity that protects against re-exposure. Moreover, mechanisms of mpox pathogenesis and immunity have not yet been elucidated. Such information is critical for vaccine strategies, epidemiologic modeling, and public health approaches. To explore this question, we developed a rhesus macaque model of mpox infection using the current outbreak strain, and we assessed virologic, immunologic, histopathologic, transcriptomic and proteomics features of acute infection and protective immunity against re-challenge.

Humoral and Cellular Immune Responses

We inoculated 18 adult rhesus macaques with mpox (hMPXV/USA/MA001/2022; Lineage B.1, Clade 2b; BEI NR-58622) at a dose of 10⁶ TCID50 (10⁸ PFU) by the intravenous (i.v.) route (Group 1; N=4), 10⁵ TCID50 (10⁷ PFU) by the i.v. route (Group 2; N=4), 10⁴ TCID50 (10⁶ PFU) by the i.v. route (Group 3; N=4), 10⁶ TCID50 (10⁸ PFU) by the intradermal (i.d.) route (Group 4; N=3), or 10⁶ TCID50 (10⁸ PFU) by the intrarectal (i.r.) route (Group 5; N=3) (Figure 1). We evaluated humoral and cellular immune responses at baseline and on days 14 and 28 following challenge.

Figure 1. Study design.

18 rhesus macaques were infected with mpox on day 0 at 10⁶ TCID50 by the i.v. route (Group 1; N=4), 10⁵ TCID50 by the i.v. route (Group 2; N=4), 10⁴ TCID50 by the i.v. route (Group 3; N=4), 10⁶ TCID50 by the i.d. route (Group 4; N=3), or 10⁶ TCID50 by the i.r. route (Group 5; N=3). On day 28, these animals as well as concurrent naïve controls (Group 6; N=3) were re-challenged with 10⁶ TCID50 by the i.v. route.

Antibody responses were assessed by enzyme-linked immunosorbent assays (ELISA), electrochemiluminescence assays (ECLA), plaque reduction neutralization titers (PRNT), and luciferase-based neutralization assays. All 18 animals developed binding antibody responses by ELISA to mpox (MPXV) antigens A35, B6, and H3 by day 14 following infection (Figure 2A). ELISA titers on day 14 were comparable following 10⁶ TCID50 i.v., 10⁵ TCID50 i.v., and 10⁶ TCID50 i.d. challenge and were approximately one log lower following 10⁴ TCID50 i.v. and 10⁶ TCID50 i.r. challenge. ECLA responses to MPXV antigens A29, A30, A35, B6, and E8 and the corresponding vaccinia virus (VACV) antigens A27, A28, A33, B5, and D8 were comparable to the ELISA responses (Figure S1).

Figure 2. Humoral immune responses in mpox challenged rhesus macaques.

Humoral immune responses were assessed at baseline, on day 14 and day 28 following challenge, and on day 42 following re-challenge by (A) binding antibody ELISA titers to A35, B6, and H3 and (B) neutralizing antibody PRNT titers to virus. Red horizontal bars reflect mean responses.

Neutralizing antibody responses by MPXV PRNT assays were observed by day 28 in the 10⁶ TCID50 i.v., 10⁵ TCID50 i.v., 10⁶ TCID50 i.d., and 10⁶ TCID50 i.r. groups but not in the 10⁴ TCID50 i.v. group (Figure 2B). PRNT titers were 1–2 logs lower than ELISA binding antibody titers but generally increased from day 14 to day 28, suggesting maturation of antibody responses. Neutralizing antibody responses were also detected by luciferase-based neutralization assays⁴ to VACV and modified vaccinia Ankara (MVA) in all groups but with lower magnitudes and slower kinetics in the 10⁴ TCID50 i.v. and 10⁶ TCID50 i.r. groups (Figure S2).

Cellular immune responses were assessed to pooled MPXV A29, A35, B6, and M1 peptides by IFN-γ intracellular cytokine staining (ICS) assays on day 28 (Figure S3). CD8+ T cell responses to these peptide pools were detected in all animals on day 28 following infection (Figure 3A). CD4+ T cell responses to these peptide pools were also detected, although borderline responses were observed in the 10⁴ TCID50 i.v. and 10⁶ TCID50 i.r. groups (Figure 3B). B6-specific IgG+ B cell responses were also detected in peripheral blood on day 28 following infection (Figure S4).

Figure 3. Cellular immune responses in mpox challenged rhesus macaques.

(A) CD8+ and (B) CD4+ T cell responses to pooled A29, A35, B6, and M1 peptides by IFN-γ intracellular cytokine staining (ICS) assays on day 28 following challenge. Dotted lines reflect limit of quantitation. Red horizontal bars reflect mean responses. Responses depicted are % IFN-γ positive CD8+ or CD4+ T cells following peptide stimulation.

Clinical Disease and Viral Loads

Clinical disease was assessed by poxvirus skin lesion counts on days 0, 3, 7, 10, 14, 21, and 28 following challenge. Skin pustules were observed on day 7 and peaked on day 10–14 following infection, with lesions observed on all limbs, head, face, neck, chest, abdomen, back, groin, and tail (Figure 4A). On day 10, we observed a median of 288 lesions per animal (range 210–462) in the 10⁶ TCID50 i.v. group, 161 lesions (range 78–249) in the 10⁵ TCID50 i.v. group, 26 lesions (range 9–121) in the 10⁴ TCID50 i.v. group, 28 lesions (range 21–159) in the 10⁶ TCID50 i.d. group, and 9 lesions (range 2–21) in the 10⁶ TCID50 i.r. group. Clinical signs included loss of appetite, reduced activity, and hunched posture, and weight loss, which generally correlated with skin lesion counts (data not shown). These data suggest that clinical disease severity was dependent on inoculum dose and route of infection, with the lowest numbers of skin lesions in the 10⁶ TCID50 i.r. group. One animal in the 10⁶ TCID50 i.d. group met criteria for humane euthanasia due to >20% weight loss on day 21. For all other animals, lesions healed by day 28.

Figure 4. Poxvirus skin lesions and viral loads following mpox challenge.

(A) Poxvirus skin lesion count and (B) plasma log viral DNA copies/ml (limit 50 copies/ml) were assessed on days 0, 3, 7, 10, 14, 21, and 28 following challenge. Red lines reflect median values.

Plasma viral DNA was assessed on days 0, 3, 7, 10, 14, 21, and 28 following challenge by RT-PCR to F3L^5,6. Viral DNA peaked on day 10 following i.v. infection and on day 7 following i.d and i.r. infection (Figure 4B). Peak viral loads were 5.66 (range 5.08–6.22) log copies/ml in the 10⁶ TCID50 i.v. group, 5.10 (range 3.69–5.56) log copies/ml in the 10⁵ TCID50 i.v. group, 2.97 (range 1.87–4.43) log copies/ml in the 10⁴ TCID50 i.v. group, 5.23 (range 5.08–5.25) log copies/ml in the 10⁶ TCID50 i.d. group, and 3.58 (range 3.06–3.70) log copies/ml in the 10⁶ TCID50 i.r. group. The lowest viral loads were in the 10⁴ TCID50 i.v. and 10⁶ TCID50 i.r. groups. Viral loads resolved by days 14–28 following challenge.

Protective Efficacy Against Re-Challenge

On day 28 following initial challenge, we re-challenged all 18 rhesus macaques as well as 3 concurrent naïve controls with 10⁶ TCID50 mpox by the i.v. route (Figure 1). All convalescent animals were fully protected against the development of poxvirus skin lesions, with zero skin lesions detected in any convalescent animal following re-challenge, whereas the 3 concurrent naïve controls showed a median of 369 lesions per animal (range 312–523) on study day 38, as expected for day 10 following infection (Figure 5A). These 3 animals were necropsied for detailed histopathology. On day 10 following re-challenge, poxvirus skin lesion counts were markedly higher in the naïve controls compared with the convalescent animals that had no skin lesions (P=0.0009, two-sided Mann-Whitney test; Figure 5C, left panel).

Figure 5. Poxvirus skin lesions and viral loads following mpox re-challenge.

On day 28, the 18 convalescent animals and 3 concurrent naïve controls were re-challenged with 10⁶ TCID50 by the i.v. route. (A) Poxvirus skin lesion count and (B) plasma log viral DNA copies/ml (limit 50 copies/ml) were assessed on study days 28, 31, 35, 38, 42, and 49, which reflect days 0, 3, 7, 10, 14, 21, and 28 following re-challenge. (C) Summary poxvirus skin lesion counts and plasma log viral DNA copes/ml on day 38, which reflects day 10 following re-challenge. **, two-sided Mann-Whitney tests. Dotted line reflects limit of quantitation. Red lines reflect median values.

Plasma viral DNA was detected transiently at borderline levels of 1.70–2.47 log copies/ml in 8 of 17 animals on day 29, which was day 1 following re-challenge, and was undetectable thereafter (Figure 5B). In contrast, the 3 concurrent naïve controls showed increasing viral loads following re-challenge to a median of 5.56 (range 4.83–6.14) log copies/ml on day 38, as expected. On day 10 following re-challenge, viral loads were markedly higher in the naïve controls compared with the convalescent animals that showed no detectable virus at that timepoint (P=0.0009, two-sided Mann-Whitney test; Figure 5C, right panel).

We speculated that the transient and low “blip” of virus in plasma for one day following re-challenge in convalescent animals (Figure 5B) may have reflected input challenge virus rather than substantive levels of new virus replication. Consistent with this possibility, humoral and cellular immune responses did not increase from day 28 to day 42 following re-challenge in the 10⁶ TCID50 i.v., 10⁵ TCID50 i.v., and 10⁶ TCID50 i.d. groups (Figures 2–3, S1–2), indicating no anamnestic immune responses in these groups. Neutralizing antibody responses increased following re-challenge in the 10⁴ TCID50 i.v. and 10⁶ TCID50 i.r. groups (Figures 2B, S2), suggesting that there may have been more virus replication in these groups, although we did not observe any increase in viral loads after day 1 following re-challenge.

Histopathology

Only limited pathology data are available to date from humans infected with the current mpox outbreak strain. To assess the pathologic characteristics of mpox infection in rhesus macaques, we performed detailed necropsies on the three sham controls on day 10 following re-challenge in the experiment described above (Figure 5B). Numerous epidermal skin vesicles and erosions were characterized by epidermal hyperkeratosis (Figure 6A), intracytoplasmic keratinocyte Guanieri-like bodies (Figure 6B), lymphohistiocytic and neutrophilic dermatitis with necrosis and syncytial cells (Figure 6C), and ballooning degeneration (Figure 6D). Skin lesions showed extensive amounts of virus by immunohistochemistry (IHC) (Figure 6E, F) and viral RNA by in situ hybridization (RNAscope) (Figure 6G, H). Generalized follicular hyperplasia without virus was also observed in the inguinal and axillary lymph nodes (data not shown). In contrast, tonsillar epithelium was positive by IHC for virus (Figure S5A), and muscle perimysium (Figure S5B) and adipocytes within the subcutaneous tissue underlying the skin lesions (Figure S5C) showed virus, suggesting local spread. In contrast, skin samples from re-challenged macaques without lesions showed no virus by IHC (Figure S5D).

Figure 6. Pathology of mpox skin lesions.

Three rhesus macaques were necropsied on day 10 following mpox challenge. (A) Hyperkeratotic epidermal hyperplasia with overlying and adjacent vesicle formation. (B) intracytoplasmic keratinocyte Guanieri-like body next to epidermal keratin pearl (insert, arrow). (C) Syncytial cells (arrows) in region of lymphohistiocytic dermatitis underlying epidermal vesicle. (D) ballooning degeneration and necrosis of sebaceous follicular epithelium (insert, arrow). (E) Poxvirus antigen by immunohistochemistry (brown) in epidemal vesicle, (F) Poxviral antigen by immunohistochemistry in regional of ballooning degeneration, proliferation, and epidermal edema in epidermal erosion. (G, H) Poxvirus RNA by RNAScope (red) in epidermal and follicular epithelium with ballooning degeneration, proliferation, and edema.

Transcriptomics

To investigate mechanistic pathways of mpox pathogenesis and immunity, we performed a transcriptomic analysis in peripheral blood on days 0, 1, 3, 7, 14, 21, and 28 after mpox challenge in the 10⁵ and 10⁶ TCID50 dose groups and on days 1, 3, 7, and 10 after mpox re-challenge (study days 29, 31, 35, and 38) (Figure S6A). Differential gene expression analysis revealed peak transcriptomic modulation (Figure S6A–F) and mpox viral RNA transcripts (Figure S6G) on day 7 following challenge, consistent with the viral load kinetics (Figure 4). Pathway enrichment analyses revealed marked upregulation of innate immune cell signatures, cytokine and chemokine signaling, and interferon and inflammatory responses on day 1 following challenge, which generally resolved by day 7–14 (Figures 7A–C, S7A–C). Following re-challenge, activation of these pathways was greatly reduced, consistent with the robust protective efficacy observed in these animals (Figures 4 and 5).

Figure 7. Transcriptomic pathways increased or decreased following mpox challenge and re-challenge.

Gene set enrichment analysis GSEA was performed on differential expression genes (DEGs) on days 1, 3, 7, 14, 21, and 28 after challenge and on days 1, 3, 7, and 10 following re-challenge (study days 29, 31, 35, and 38). The GSEA normalized enrichment score (NES) is shown for each pathway across time. Circle size is proportional to the NES, and circle color is proportional to the -log₁₀ FDR q value. Color gradient corresponds to the NES, where increased pathways (A–D) were shown in red and downregulated pathways (E, G) in blue. Insignificant pathways were shown in small open dark circles (FDR q value >0.05). F, H show the GSEA rank of the top downregulated genes associated with extracellular matrix (F) and metabolism (H).

Gene signatures of T cell activation and differentiation, including CD4, CD8, and TFH cells, increased significantly on day 7 following initial challenge, and signatures of B cells and plasma cells increased on day 14 following initial challenge (Figures 7D, S7D–E). In contrast, more rapid activation of T cell and plasma cell pathways was observed by day 3 following re-challenge (study day 31). These data suggest a role of T cell responses in control of acute mpox infection, and a potential key role of anamnestic T and B cell responses in natural immunity and protection against re-challenge. We also observed upregulation of TH17 pathways following initial challenge (Figure S7F)⁷.

We also observed significant downregulation of transcriptomic pathways associated with cell movement and adhesion, collagen formation, wound healing, and extracellular matrix organization (Figure 7E–F) and metabolic pathways (Figure 7G–H)⁸ following initial challenge. These observations were validated by serum proteomics, which similarly showed downregulation of these pathways as well as mTOR pathways following mpox infection (Figure S7G–L)^9–11. These data suggest potential mechanisms by which mpox infection leads to skin breakdown and cellular metabolic dysfunction.

Discussion

Little is currently known about pathogenesis and immunity following infection with the current mpox outbreak strain, but clinical and epidemiologic studies suggest substantial differences from prior mpox outbreaks^2,3. The current mpox outbreak is characterized by skin-to-skin and/or sexual spread primarily in MSM, whereas prior mpox outbreaks were associated with animal reservoirs and limited human-to-human spread. We, therefore, developed a rhesus macaque model of mpox infection by the intravenous, intradermal, and intrarectal routes, with the latter two routes as models for the current mpox outbreak. Intrarectal infection induced comparatively lower humoral immune responses. All three routes of exposure resulted in productive infection and induced robust humoral and cellular immune responses that provided complete or near complete protection against re-challenge. These data demonstrate that mpox infection by all three routes induces robust natural immunity, which has important implications for vaccines and public health interventions.

This rhesus macaque model of mpox infection recapitulates many aspects of human mpox infection, including the development of numerous poxvirus skin lesions following i.v. infection and fewer skin lesions following i.r. infection². The skin lesions showed acute inflammation with extensive virus and underlying neutrophilic dermatitis. Prior macaque mpox challenge studies utilized older virus strains administered primarily by the i.v. route^12–15, which is likely not the most common route of clinical exposure in the current outbreak. Mpox infection by the i.r. route resulted in lower antibody responses, fewer skin lesions, and reduced viral loads compared with the i.v. or the i.d. routes. Nevertheless, macaques infected by the i.r. route were still robustly protected against a high-dose re-challenge by the i.v. route, suggesting that relatively low antibody titers prior to re-challenge (median ELISA titers 1578–3740; median PRNT titers 160) may be sufficient to confer protective immunity in this model. Cellular immune responses likely also contribute to protective efficacy, although the relative importance of humoral and cellular immunity remains to be determined.

Our data demonstrate outstanding protective efficacy of natural immunity induced by all three routes of mpox exposure against re-challenge. The transcriptomic studies showed robust upregulation of innate and inflammatory responses and activation of T and B cell signaling following initial infection, as well as downregulation of collagen formation, extracellular matrix organization, and metabolic pathways, which provide insights into acute mpox pathogenesis. Following re-challenge, innate and inflammatory signaling was markedly reduced, whereas activation of T cell and plasma cell signaling was remarkably rapid, suggesting that anamnestic cellular and humoral immune responses may be key for protective efficacy against re-challenge. Collectively, these observations provide mechanistic insights into mpox pathogenesis and immunity. In addition, this macaque model should prove useful for testing mpox vaccines and therapeutics.

Limitations of Study.

Limitations of the current study include the small numbers of animals per group as well as short follow-up time. In addition, there may be important differences between experimental mpox infection in macaques and humans, such as differences in challenge virus dose.

STAR Methods

RESOURCE AVAILABILITY

Lead contact

Any further information or requests should be directed to, and will be fulfilled by, Dr. Dan H. Barouch (dbarouch@bidmc.harvard.edu).

Materials availability

This study did not generate new unique reagents.

Data and code availability

Raw bulk RNA-Seq has been submitted to the National Center for Biotechnology Information Gene Expression Omnibus (http://www.ncbi.nlm.nih.gov/geo) under accession number GEO: GSE234118. Accession numbers are listed in the key resources table. Code used is from previously established R packages, and any information required to reanalyze the data reported in this paper is available from the lead contact upon request.

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Anti-rhesus IgG1/3 [1B3]-HRP	Nonhuman Primate Reagent Resource (NHPRR)	AB_2819289
ICS and ELISpots	21st Century Biochemicals	M1R, A29L, A35R, and B6R (peptides)
Bacterial and virus strains
mpox (hMPXV/USA/MA001/2022; Lineage B.1, Clade 2b; BEI NR-58622)	Barouch laboratory (this paper)	N/A
MVA:Luc (MVA luciferase reporter virus)	Dr. Mariano Esteban, Centro National de Biotechnologia, Madrid, Spain	N/A
VV:Luc (Vaccinia Western Reserve luciferase reporter virus)	Dr. David Bartlett, University of Pittsburgh, USA	N/A
Biological samples
Chemicals, peptides, and recombinant proteins
Critical commercial assays
U-PLEX Assay Platform (Multiplex ELISA)	Meso Scale Discovery	MSD U-PLEX
NextSeq 500 System WGS Solution (bulk RNA-sequencing)	Illumina, Raczy et al.	NextSeq 500
Deposited data
Raw and analyzed data	This paper	GSE234118
Experimental models: Cell lines
HeLa	ATCC, Manassas, VA	CCL-2
DF-1	Dr. Mark Feinberg, Emory Vaccine Center	N/A
Experimental models: Organisms/strains
rhesus monkeys (Macaca mulatta)	Bioqual, Rockville, MD	N/A
Oligonucleotides
Recombinant DNA
Software and algorithms
R (version 4.1.3)	R Core Team	R.4.1.3
STAR: RNA-seq aligner (version 2.7.10a)	Dobin et al.	STAR
R package: Classification And REgression Training (version 6.0–94)	Kuhn	caret
R package: mixOmics (version 6.24.0)	Lê Cao et al.	mixOmics
R package: Pam: prediction analysis for microarrays (version 1.56.1)	Hastie et al.	pamR
Gene Set Enrichment Analysis (version 4.2.3)	Subramanian et al., Mootha et al.	GSEA_4.2.3
R package: Differential gene expression analysis based on the negative binomial distribution (version 1.40.1)	Love et al.	DESeq2
GraphPad Prism 9.0.0	GraphPad Software	N/A
VersaMax Tunable Microplate Reader	Molecular Devices	N/A
Other

EXPERIMENTAL MODEL AND STUDY PARTICIPANT DETAILS

21 outbred Indian-origin adult male and female rhesus macaques (Macaca mulatta), 8–12 years old, were randomly allocated to groups. All animals were housed at Bioqual, Inc. (Rockville, MD). We inoculated 18 adult rhesus macaques with mpox at a dose of 10⁶ TCID50 by the intravenous (i.v.) route (Group 1; N=4), 10⁵ TCID50 by the i.v. route (Group 2; N=4), 10⁴ TCID50 by the i.v. route (Group 3; N=4), 10⁶ TCID50 by the intradermal (i.d.) route (Group 4; N=3), or 10⁶ TCID50 by the intrarectal (i.r.) route (Group 5; N=3). On day 28 following challenge, all animals plus 3 concurrent naïve controls (Group 6; N=3) were re-challenged with 10⁶ TCID50 mpox by the i.v. route. These 3 concurrent naïve controls were necropsied on day 38, refleting day 10 following infection, for histopathology. Semi-quantitative scoring was utilized for clinical symptoms, and poxvirus skin lesions were counted. All immunologic and virologic assays were performed blinded. All animal studies were performed in animal biosafety level 3 (ABSL-3) containment and were conducted in compliance with all relevant local, state, and federal regulations and were approved by the Bioqual Institutional Animal Care and Use Committee (IACUC).

METHOD DETAILS

Challenge stock.

We utilized the mpox stock from the current outbreak hMPXV/USA/MA001/2022, Lineage B.1, Clade 2b (BEI NR-58622). The stock concentration was calculated at 1.8×10⁶ TCID50/mL in BSC-40 cells as well as 1.8×10⁸ PFU/mL in Vero cells.

Viral DNA assay.

Mpox DNA was assessed by RT-PCR targeting the F3L (GenBank accession URK20488) gene as previously described^5,6. A standard was generated by first synthesizing gene fragments of the F3L gene. The gene fragment was subsequently cloned into a pcDNA3.1+ expression plasmid using restriction site cloning (Integrated DNA Technologies). Log dilutions of the standard were prepared for RT-PCR assays ranging from 1×10¹⁰ copies to 1×10⁻¹ copies. Viral loads were quantified from plasma. DNA extraction was performed on a QIAcube HT using the QIAamp 96 DNA Blood Kit according to manufacturer’s specifications (Qiagen). A gene expression assay was designed using oligonucleotide primers (Integrated DNA Technologies) and BHQ probes (Biosearch Technologies) targeting the F3L gene. Primer and probe sequences were chosen on the basis of length and melting point. The sequences for the custom assays were as follows. F3L.forward: CATCTATTATAGCATCAGCATCAGA, F3L.reverse: GATACTCCTCCTCGTTGGTCTAC, F3L.probe: FAM-TGTAGGCCGTGTATCAGCATCCATT-BHQ1. Reactions were carried out in duplicate for samples and standards on the QuantStudio 6 and 7 Flex Real-Time PCR Systems (Applied Biosystems) with the thermal cycling conditions: initial denaturation at 95°C for 20 seconds, then 45 cycles of 95°C for 1 second and 60°C for 20 seconds. Standard curves were used to calculate DNA copies per ml. The quantitative assay sensitivity was determined as 50 copies/ml.

Enzyme-linked immunosorbent assay (ELISA).

Mpox binding antibodies in serum were assessed by ELISA. 96-well plates were coated with 1 μg/mL of similarly produced Mpox A35, B6R, H3L or M1R protein (Sino Biological) in 1× Dulbecco phosphate-buffered saline (DPBS) and incubated at 4 °C overnight. After incubation, plates were washed once with wash buffer (0.05% Tween 20 in 1× DPBS) and blocked with 350 μL of casein block solution per well for 2 to 3 hours at room temperature. Following incubation, block solution was discarded, and plates were blotted dry. Serial dilutions of heat-inactivated serum diluted in Casein block were added to wells, and plates were incubated for 1 hour at room temperature, prior to 3 more washes and a 1-hour incubation with a 1μg/mL dilution of anti–macaque IgG horseradish peroxidase (NIH Nonhuman Primate Reagent Resource) at room temperature in the dark. Plates were washed 3 times, and 100 μL of SeraCare KPL TMB SureBlue Start solution was added to each well; plate development was halted by adding 100 μL of SeraCare KPL TMB Stop solution per well. The absorbance at 450 nm, with a reference at 650 nm, was recorded with a VersaMax microplate reader (Molecular Devices). For each sample, the ELISA end point titer was calculated using a 4-parameter logistic curve fit to calculate the reciprocal serum dilution that yields a corrected absorbance value (450 nm – 650 nm) of 0.2. Interpolated end point titers were reported.

Electrochemiluminescence assay (ECLA).

ECLA plates (MesoScale Discovery Orthopox IgG) were designed and produced with up to 10 antigen spots in each well, with paired antigens from vaccinia virus (VACV) and monkeypox virus (MPXV) L1R/M1R, A28/A30L, A27L/A29L, A33R/A35R, B5/B6R, and D8L/E8L. The plates were blocked with 50 uL of Blocker A (1% BSA in distilled water) solution for at least 30 minutes at room temperature shaking at 700 rpm with a digital microplate shaker. During blocking the serum was diluted to 1:5,000 in Diluent 100. The calibrator curve was prepared by diluting the calibrator mixture from MSD 1:9 in Diluent 100 and then preparing a 7-step 4-fold dilution series plus a blank containing only Diluent 100. The plates were then washed 3 times with 150 μL of Wash Buffer (0.5% Tween in 1x PBS), blotted dry, and 50 μL of the diluted samples and calibration curve were added in duplicate to the plates and set to shake at 700 rpm at room temperature for at least 2 h. The plates were again washed 3 times and 50 μL of sulfo-tagged anti-human IgG detection antibody diluted to 1x in Diluent 100 was added to each well and incubated shaking at 700 rpm at room temperature for at least 1 h. Plates were then washed 3 times and 150 μL of MSD GOLD Read Buffer B was added to each well and the plates were read immediately after on a MESO QuickPlex SQ 120 machine. MSD titers for each sample was reported as Relative Light Units (RLU) which were calculated using the calibrator.

Plaque reduction neutralization titer (PRNT) assay.

Serum samples were heat inactivated for 30 minutes at 56°C. Briefly, serum samples were serially diluted in media and added to equal volume of a fixed dilution of the MPXV (BEI Resources, NR-58622). The serum-virus mixture was then incubated for 15–18 hours at 2–8°C. Subsequently, 250μL of each serum-virus mixture was added in duplicate to a near confluent monolayer of Vero E6 cells (ATCC, Cat. # CRL-1586) and incubated at 37°C; 5% CO2 for 1 hour. Afterwards, 0.5 mL of 0.5% methylcellulose in DMEM + 10% FBS was added to each well and incubated at 37°C, 5% CO2 for 48 ± 4 hours, overlay medium removed, and then stained with 0.4% Crystal Violet solution for the enumeration of the plaques. Neutralization end-point titers were calculated via point-to-point linear regression and based on the reciprocal dilution of the test serum that produced 50% plaque reduction compared to the virus only control (PRNT50).

Vaccinia and MVA neutralization assays.

Neutralizing antibody responses against vaccinia virus Western reserve (VV:WR) and modified vaccinia Ankara (MVA) were measured using a luciferase-based assay in HeLa or DF-1 cells, as previously described⁴. This assay measures the reduction in luciferase reporter gene expression in target cells following a single-round of virus infection. Briefly, 3-fold serial dilutions of serum samples were performed in duplicate (96-well flat bottom plate) in 10% D-MEM growth media (100 ul/well). VV:Luc or MVA:Luc virus (5×10⁴ PFU) was added to each well in a volume of 50 ul and the plates were incubated for 1 hour at 37°C. HeLa (VV:Luc assays) or DF-1 (MVA:Luc assays) cells were then added (5×10⁴/well in 50 ml volume) in 10% D-MEM growth medium to achieve a multiplicity of infection (MOI) of 1:1. Cytosine arabinofuranoside (Sigma, St. Louis, MO) was added at a final concentration of 20 ug/ml to prevent secondary rounds of infection. Assay controls included replicate wells of target cells alone (cell control) and target cells with virus (virus control). Following an overnight incubation at 37°C, 100 ul of assay medium was removed from each well and 100 ul of Bright-Glo luciferase reagent (Promega, Madison, WI) was added. The cells were allowed to lyse for 2 min, then 150 ul of the cell lysate was transferred to a 96-well black solid plate and luminescence was measured using a GloMax Navigator luminometer (Promega). The ID50 titer was calculated as the serum dilution that caused a 50% reduction in relative luminescence units (RLU) compared to the virus control wells after subtraction of cell control RLUs. Vaccinia immunoglobulin (VIG) was utilized as a positive control reagent for all neutralization assays performed.

Intracellular cytokine staining (ICS) assay.

CD4+ and CD8+ T cell responses were quantitated by pooled peptide-stimulated intracellular cytokine staining (ICS) assays. Peptide pools were 16 amino acid peptides overlapping by 11 amino acids of Mpox A29, A35, B6, and M1 peptides (21^st Century Biochemicals). 10⁶ peripheral blood mononuclear cells well were re-suspended in 100 μL of R10 media supplemented with CD49d monoclonal antibody (1 μg/mL). Each sample was assessed with mock (100 μL of R10 plus 0.5% DMSO; background control), peptides (2 μg/mL), and/or 10 ng/mL phorbol myristate acetate (PMA) and 1 μg/mL ionomycin (Sigma-Aldrich) (100μL; positive control) and incubated at 37°C for 1 h. After incubation, 0.25 μL of GolgiStop and 0.25 μL of GolgiPlug in 50 μL of R10 was added to each well and incubated at 37°C for 8 h and then held at 4°C overnight. The next day, the cells were washed twice with DPBS, stained with Near IR live/dead dye for 10 mins and then stained with predetermined titers of mAbs against CD279 (clone EH12.1, BB700), CD38 (clone OKT10, PE), CD28 (clone 28.2, PE CY5), CD4 (clone L200, BV510), CD45 (clone D058–1283, BUV615), CD95 (clone DX2, BUV737), CD8 (clone SK1, BUV805), for 30 min. Cells were then washed twice with 2% FBS/DPBS buffer and incubated for 15 min with 200 μL of BD

CytoFix/CytoPerm Fixation/Permeabilization solution.

Cells were washed twice with 1X Perm Wash buffer (BD Perm/WashTM Buffer 10X in the CytoFix/CytoPerm Fixation/Permeabilization kit diluted with MilliQ water and passed through 0.22μm filter) and stained with intracellularly with monoclonal antibodies against Ki67 (clone B56, FITC), CD69 (clone TP1.55.3, ECD), IL10 (clone JES3–9D7, PE CY7), IL13 (clone JES10–5A2, BV421), TNF-α (clone Mab11, BV650), IL4 (clone MP4–25D2, BV711), IFN-γ (clone B27; BUV395), IL2 (clone MQ1–17H12, APC), CD3 (clone SP34.2, Alexa 700), for 30 min. Cells were washed twice with 1X Perm Wash buffer and fixed with 250μL of freshly prepared 1.5% formaldehyde. Fixed cells were transferred to 96-well round bottom plate and analyzed by BD FACSymphony^™ system. Data were analyzed using FlowJo v10.8.1.

B cell staining.

Fresh PBMCs were stained with Aqua live/dead dye (Invitrogen) for 20 min, washed with 2% FBS/DPBS buffer, and suspended in 2% FBS/DPBS buffer with Fc Block (BD) for 10 min, followed by staining with monoclonal antibodies against CD45 (clone D058–1283, BUV805), CD3 (clone SP34.2, APC-Cy7), CD7 (clone M-T701, Alexa700), CD123 (clone 6H6, Alexa700), CD11c (clone 3.9, Alexa700), CD20 (clone 2H7, PE-Cy5), IgA (goat polyclonal antibodies, APC), IgG (clone G18–145, BUV737), IgM (clone G20–127, BUV396), IgD (goat polyclonal antibodies, PE), CD80 (clone L307.4, BV786), CD95 (clone DX2, BV711), CD27 (clone M-T271, BUV563), CD21 (clone B-ly4, BV605), CD14 (clone M5E2, BV570). Cells were also stained with Mpox antigens including M1R(Cell Sciences) proteins labeled with FITC and PE, B6R (Cell Sciences) labeled with DyLight 405 or APC (DyLight^® 405 Conjugation Kit, FITC Conjugation Kit, PE / R-Phycoerythrin Conjugation Kit, APC Conjugation Kit, Abcam), at 4°C for 30 min. After staining, cells were washed twice with 2% FBS/DPBS buffer, and fixed by 2% paraformaldehyde. All data were acquired on a BD FACSymphony flow cytometer. Subsequent analyses were performed using FlowJo software (Treestar, v10.8.1).

Histopathology and immunohistochemistry (IHC).

Tissues were fixed in freshly prepared 4% paraformaldehyde for 24 hours, transferred to 70% ethanol, and paraffin embedded and blocks sectioned at 5 μm. Slides were baked for 30–60 min at 65°C then deparaffinized in xylene and rehydrated through a series of graded ethanol to distilled water. For IHC, heat induced epitope retrieval (HIER) was performed using a pressure cooker on steam setting for 25 min in citrate buffer (Thermo; AP-9003–500) followed by treatment with 3% hydrogen peroxide. Slides were then rinsed in distilled water and protein blocked (BioCare, BE965H) for 15 min followed by rinses in 1x phosphate buffered saline. Primary mouse anti-Vaccinia antibody (Santa Cruz; SC-58210) was applied at 1:100 followed by mouse Mach-2 HRP-Polymer (MHRP520 ) for 30 min, then Nova-Red (Vector, SK4800) for 10 min, and counterstained with hematoxylin followed by bluing using 0.25% ammonia water. IHC was performed using a Biocare intelliPATH autostainer. Tissue pathology was assessed by a board-certified veterinary pathologist (AJM).

RNAscope in situ hybridization.

RNA scope in site hybridization was performed using a specific probe v-monkeypox (ACD 534671), DapB (ACD 310043) as a negative control, and Ppib Mmu (ACD 457711) as a positive control. In brief, after slides were deparaffinized in xylene and rehydrated through ethanol, retrieval was performed for 25 min in ACD P2 retrieval buffer (ACD 322000) at 95–98°C, followed by treatment with protease plus (ACD 322331) for 20 min at 40°C. Prior to hybridization, probe stocks were incubated for 10 min at 40°C. Slides were developed using the RNAscope 2.5 HD Detection Reagents-RED (ACD 322360) for 10 min.

Bulk RNA sequencing.

Blood was collected into PAXgene Blood RNA tubes (BD Biosciences) and the RNA was extracted using the MagMAX for Stabilized Blood Tubes RNA Isolation Kit, compatible with PAXgene Blood RNA Tubes (ThermoFisher Scientific). RNA quality was assessed using a TapeStation 4200 (Agilent) and then one microgram of total RNA was subjected to globin transcript depletion using the GLOBINclear Kit, human (ThermoFisher Scientific). Ten nanograms of the globin-depleted RNA was used as input for cDNA synthesis using the Clontech SMART-Seq v4 Ultra Low Input RNA kit (Takara Bio) according to the manufacturer’s instructions. Amplified cDNA was fragmented and appended with dual-indexed bar codes using the Nextera XT DNA Library Preparation kit (Illumina). Libraries were validated by capillary electrophoresis on a TapeStation 4200 (Agilent), pooled at equimolar concentrations, and sequenced with PE100 reads on an Illumina NovaSeq 6000, yielding ~35 million reads per sample on average. Alignment was performed using STAR version 2.7.9a^16, and transcripts were annotated using a composite reference, including the Mmul10 assembly and annotation of the Indian rhesus macaque genome¹⁷ and the ASM1462154v1 assembly of the MPOX genome. Transcript abundance estimates were calculated internally to the STAR aligner using the algorithm of htseq-count¹⁸. DESeq2 was used for normalization¹⁹.

Differential gene expression.

Differential expression at the gene level was performed using the raw count’s matrices by DESeq2 implemented in the DESeq2 R package¹⁹. Adjusted P-values (<0.05) were calculated by DEseq2 using Benjamini-Hochberg corrections of Wald test p-values to assess significant genes that were upregulated or downregulated in macaques that exhibited rebound viremia following ATI. Gene Set Enrichment Analysis (GSEA)²⁰ throughout the study was performed to assess enrichment in pathways after challenge and rechallenge with MPOX compared with baseline (day 0). Briefly, genes were pre-ranked using the log2 fold change expression, and the enrichment of various genesets was tested after running 1000 permutations of enrichment. MSigDB database C2²¹, and the BTM modules²² were used to identify pathways that differentiated rebounders and non-rebounders using an FDR q value cut-off of 0.05.

Plasma proteomics.

We collected plasma samples from all animals on days 0, 1, 3, 7, 14, 21, and 28 after challenge and on days 29, 31, 35, and 38 after rechallenge for proteomics profiling using the Somascan platform²³. 55uL of plasma, five pooled serum controls, and one buffer control were analyzed using the SomaScan^® Assay Kit for human serum V4.1 (Cat#. 900–00021), measuring the expression of 6596 unique human protein targets using 7596 SOMAmer (slow off-rate modified aptamer) reagents, single-stranded DNA aptamers, according to the manufacturer’s standard protocol (SomaLogic; Boulder, CO). The modified aptamer binding reagents, SomaScan Assay, its performance characteristics, and specificity to human targets have been previously described²³. The assay used standard controls, including 12 hybridization normalization control sequences used to control for variability in the Agilent microarray readout process, as well as five human calibrator control pooled serum replicates and 3 Quality Control (QC) pooled replicates used to mitigate batch effects and verify the quality of the assay run using standard acceptance criteria. The readout is performed using Agilent microarray hybridization, scan, and feature extraction technology. Twelve Hybridization Control SOMAmers are added alongside SOMAmers to be measured from the serum samples and controls of each well during the SOMAmer elution step to control for readout variability. The control samples are run repeatedly during assay qualification and robust point estimates are generated and stored as references for each SOMAmer result for the Calibrator and QC samples. The results are used as references for the SomaScan V4.1 (or SomaScan V4.0) Assay. Plate calibration is performed by calculating the ratio of the Calibrator Reference relative fluorescence unit (RFU) value to the plate-specific Calibrator replicate median RFU value for each SOMAmer. The resulting ratio distribution is decomposed into a Plate Scale factor defined by the median of the distribution and a vector of SOMAmer-specific Calibration Scale Factors. Normalization of QC replicates and samples is performed using Adaptive Normalization by Maximum Likelihood (ANML) with point and variance estimates from a normal U.S. population. Post-calibration accuracy is estimated using the ratio of the QC reference RFU value to the plate-specific QC replicate median RFU value for each SOMAmer. The resulting QC ratio distribution provides a robust estimate of accuracy for each SOMAmer on every plate. Plate-specific Acceptance Criteria are as follows: Plate Scale Factor between 0.4–2.5 and 85% of QC ratios between 0.8 and 1.2. For platform standardization, all RFU values across all samples were converted to the SomaScan V4.0 using Somascan internal scaling factors. We used the Linear Models for Microarray Data (Limma) R package²⁴ to identify differentially expressed proteins. The method involves fitting a linear model to the data and then performing a t-test to identify proteins that are differentially expressed between two or more groups. P values were corrected for multiple testing using the Benamini-Hochberg method and a cut-off of <0.05 was used to select significant up- or downregulated proteins following MPOX infection compared with baseline day 0.

QUANTIFICATION AND STATISTICAL ANALYSIS

Analysis of virologic and immunologic data was performed using GraphPad Prism 9.0.0 (GraphPad Software). Comparison of data between groups was performed using 2-sided Mann-Whitney tests. P-values of less than 0.05 were considered significant.

Highlights.

• Mpox infection by three routes induces robust natural immunity

• Natural immunity protects against mpox re-challenge

• Adaptive immune responses appear critical for protection