KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| PE LCMV I-A(b) GP66-77 tetramer | NIH Tetramer Core Facility | https://tetramer.yerkes.emory.edu |
| PE or APC LCMV DbGP33 tetramer | NIH Tetramer Core Facility | https://tetramer.yerkes.emory.edu |
| PE LCMV DbGP276 tetramer | NIH Tetramer Core Facility | https://tetramer.yerkes.emory.edu |
| PE LCMV DbNP396 tetramer | NIH Tetramer Core Facility | https://tetramer.yerkes.emory.edu |
| BV711 anti-mouse CD4 | BioLegend | Cat# 100549, RRID:AB_11219396 |
| BV510 anti-mouse/human CD44 | BioLegend | Cat# 103044, RRID:AB_2650923 |
| APC anti-mouse CD185 (CXCR5) | BioLegend | Cat# 145506, RRID: AB_2561970 |
| PE/Cyanine7 anti-mouse CX3CR1 | BioLegend | Cat#149016, RRID: AB_2565700 |
| APC/Cyanine7 anti-mouse CD279 (PD-1) | BioLegend | Cat#, 135224 RRID: AB_2563523 |
| PE/Dazzle 594 anti-mouse CD186 (CXCR6) | BioLegend | Cat# 151117, RRID:AB_2721700 |
| PE/Dazzle 594 anti-mouse/human CD45R/B220 Antibody | BioLegend | Cat# 103258, RRID:AB_2564053 |
| APC anti-mouse CD138 (Syndecan-1) | Biolegend | Cat# 142505, RRID:AB_10960141 |
| FITC anti-MU/HU GL7 Antigen (T/B Cell Act. Marker) | BioLegend | Cat# 144604, RRID:AB_2561697 |
| APC/Cyanine7 anti-mouse IgM | Biolegend | Cat# 406515, RRID:AB_10690815 |
| PE anti-mouse CD95 (Fas) | BioLegend | Cat# 152608, RRID:AB_2632902 |
| Brilliant Violet 421 anti-mouse IgD | Biolegend | Cat# 405725, RRID:AB_2562743 |
| Brilliant Violet 711 anti-mouse CD8a | Biolegend | Cat# 100748, RRID:AB_2562100 |
| APC anti-mouse CD223 (LAG-3) | Biolegend | Cat# 125209, RRID:AB_10639935 |
| PE/Cyanine7 anti-mouse CD186 (CXCR6) | Biolegend | Cat# 151119, RRID:AB_2721670 |
| CD366 (TIM3) Monoclonal Antibody (RMT3-23), FITC, | eBioscience | Cat# 11-5870-82, RRID:AB_2688129 |
| TOX Antibody, anti-human/mouse, PE, REAfinity™ | Miltenyi Biotec | Cat# 130-120-716, RRID:AB_2801780 |
| APC anti-T-bet | Biolegend | Cat# 644814, RRID:AB_10901173 |
| PE anti-T-bet | Biolegend | Cat# 644810, RRID:AB_2200542 |
| EOMES Monoclonal Antibody (Dan11mag), PE-Cyanine7 | eBioscience | Cat# 25-4875-82, RRID:AB_2573454 |
| FITC Donkey anti-rabbit IgG (min. x-reactivity) | Biolegend | Cat# 406403, RRID:AB_893531 |
| PE/Cyanine7 anti-mouse IFN-gamma | Biolegend | Cat# 505826, RRID:AB_2295770 |
| APC anti-mouse/rat TNF-alpha | Biolegend | Cat# 506108, RRID:AB_2721315 |
| APC/Cyanine7 anti-mouse CD107a (LAMP-1) | Biolegend | Cat# 121616, RRID:AB_10643268 |
| PE/Dazzle 594 anti-human/mouse Granzyme B Recombinant | Biolegend | Cat# 372215, RRID:AB_2728382 |
| APC/Cyanine7 anti-mouse/human CD44 | BioLegend | Cat# 103028, RRID:AB_830785 |
| PE/Cyanine7 anti-mouse CD279 (PD-1) | BioLegend | Cat# 135216, RRID:AB_10689635 |
| PE/Dazzle 594 anti-mouse CX3CR1 | BioLegend | Cat# 149014, RRID:AB_2565698 |
| Pacific Blue anti-mouse Ly108 | BioLegend | Cat# 134608, RRID:AB_2188093 |
| Pacific Blue anti-mouse CD45.2 | BioLegend | Cat# 109820, RRID:AB_492872 |
| APC/Cyanine7 anti-mouse/human KLRG1 (MAFA) | Biolegend | Cat# 138425, RRID:AB_2566553 |
| BV480 Rat Anti-Mouse CD8a | BDbiosciences | Cat# 566096, RRID:AB_2739500 |
| BV510 anti-mouse CD366 (TIM-3) | BDbiosciences | Cat# 747625, RRID:AB_2744191 |
| Brilliant Violet 605(TM) anti-mouse CX3CR1 | Biolegend | Cat# 149027, RRID:AB_2565937 |
| BV650 anti-mouse TIGIT | BDbiosciences | Cat# 744213, RRID:AB_2742062 |
| Brilliant Violet 711(TM) anti-mouse CD186 (CXCR6) | Biolegend | Cat# 151111, RRID:AB_2721558 |
| Brilliant Violet 785(TM) anti-mouse CD45.1 | Biolegend | Cat# 110743, RRID:AB_2563379 |
| FITC anti-rat CD90/mouse CD90.1 (Thy-1.1) | Biolegend | Cat# 202504, RRID:AB_1595653 |
| PE/Cyanine5 anti-mouse/human CD44 | Biolegend | Cat# 103009, RRID:AB_312960 |
| BUV395 anti-mouse CD44 | BDbiosciences | Cat# 740215, RRID:AB_2739963 |
| PE/Cyanine7 anti-mouse CD94 | Biolegend | Cat# 105509, RRID:AB_2632663 |
| Bacterial and virus strains | ||
| LCMV Clone 13 | Rafi Ahmed, PhD | Grown in house |
| Chemicals, peptides, and recombinant proteins | ||
| Brefeldin A Solution (1,000X) | Biolegend | Cat#420601 |
| Fixation Buffer | Biolegend | Cat#420801 |
| KAVYNFATM (GP3341) peptide | GenScript | RP20-257 |
| True Nuclear Transcription Factor Buffer Set | Biolegend | Cat#424401 |
| Live/Dead Fixable Aqua Kit | ThermoFisher | Cat# L34957 |
| Collagenase, Type 1 | Worthington | Cat# LS004194 |
| DNase I | Milipore Sigma | Cat# 10104159001 |
| Critical commercial assays | ||
| EasySep Mouse CD8+ T cell isolation Kit | Stem Cell | Cat#19853 |
| EasySep™ Mouse Naive CD8+ T cell Isolation Kit | Stem Cell | Cat#19858 |
| Chromium Next GEM Single Cell Multiome ATAC + Gene Expression Reagent Bundle, 4 rxns | 10X Genomics | Cat# 1000285 |
| Dynabeads™ MyOne™ SILANE | 10x Genomics | Cat# PN-2000048 |
| Library Construction Kit | 10x Genomics | Cat# PN-1000190 |
| Dual Index Kit TT Set A | 10x Genomics | Cat# PN-1000215 |
| SPRIselect Reagent Kit | Beckman Coulter | Cat#B23318 |
| Kappa NGS quantification kit | KAPABiosystems | Cat#KK4824 |
| NextSeq 500/550 High Output Kit v2.5 (150 cycles) | Illumina | Cat#20024907 |
| HSD5000 ScreenTape | Agilent | Cat# 5067-5592 |
| Agencourt AMPure XP | Beckman Coulter | Cat# A63880 |
| Deposited data | ||
| Single cell ATAC + RNAseq, Bulk ATCAseq and Bulk RNAseq from CD45.1+ P14 CD8+ T cells, day 21 post-LCMV Cl13 infection | This paper | GSE222346 |
| scRNAseq from GP33+ CD8 T cells, day 30 post LCMV Cl13 infection | Zander et al.15 | GSE129139 |
| Experimental models: Organisms/strains | ||
| C57BL/6 mice | Charles River | N/A |
| CD45.1 congenic mice | Charles River | N/A |
| Vav-cre+; Arid2flox/flox mice | Previous study | Bluemn et al.75 |
| B16-DBGP33 (B16gp33) | Prévost-Blondel et al.76 | Grown in house |
| Oligonucleotides | ||
| GCCGTTTAAGAAGATCCCTG (Arid2_gRNA#1) | This paper | Synthego |
| TCCGCCTAAAGTAGTGACTC (Arid2_gRNA#2) | This paper | Synthego |
| TGATCCATACTGAAGTGCCA (Pbrm1_gRNA#1) | This paper | Synthego |
| TCCAGAAAACTTTCGCGATG (Pbrm1_gRNA#2) | This paper | Synthego |
| Software and algorithms | ||
| Cell Ranger 6.0 | 10x Genomics | https://support.10xgenomics.com/single-cell-gene-expression/software/pipelines/latest/installation |
| Seurat 4.0.6 | Butler et al. and Stuart et al.77,78 | https://satijalab.org/seurat/ |
| FlowJo 10.7.1 | Tree Star | N/A |
| Prism 9 | Graphpad Software | N/A |
| Cytobank | Beckman Coulter | https://support.cytobank.org/hc/en-us |
| Signac 1.9.0 | Stuart et al.79 | https://stuartlab.org/signac/ |
| Tidyverse 1.3.2 | Wickham et al.80 | https://www.tidyverse.org/ |
| Complex Heatmap 3.17 | Gu et al.81 | https://github.com/jokergoo/ComplexHeatmap |
| Biorender | N/A | Biorender.com |