KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
|
| ||
| Antibodies | ||
|
| ||
| Anti-MTF1 (H-300) rabbit polyclonal primary | Santa Cruz Biotechnology | Cat# Sc-48775; RRID:AB_2235184 |
| Anti-MT rabbit (FL-61) polyclonal IgG primary | Santa Cruz Biotechnology | Cat# Sc-11377; RRID:AB_2146825 |
| Anti-α-Tubulin mouse monoclonal primary | Santa Cruz Biotechnology | Cat# Sc-5266; RRID:AB_627308 |
| Goat anti-mouse (H + L) IgG secondary | Novus Biotechnology | Cat# NB7539 |
| Goat anti-Rabbit (H + L) IgG secondary | Novus Biotechnology | Cat# NB7160 |
|
| ||
| Chemicals, peptides, and recombinant proteins | ||
|
| ||
| Tris(2-pyridylmethyl) amine 98% (TPA) | Sigma-Aldrich | Cat# 723134 |
| Zinc chloride, anhydrous, 99.95% (metals basis) | Aifa Aesar | Cat# 87900 |
| Zinc chloride, 0.1 M solution | Sigma-Aldrich | Cat# 39059 |
| Chelex-100, sodium form | Sigma-Aldrich | Cat# C7901 |
| Nonidet P-40 | Sigma-Aldrich | Cat# 74385 |
| Sodium deoxycholate | Sigma-Aldrich | Cat# D6750 |
| Protease and Phosphatase Inhibitor Cocktail (PPi) | Thermo Scientific | Cat# 78441 |
| (S)-(+)-Camptothecin, ≥90% (HPLC), powder | Sigma-Aldrch | Cat# C9911 |
| Janelia Fluor 669 Halo-Tag dye (JF669) Campus | Laboratory of Luke Lavis, Janelia Research | N/A |
| DMEM/F12, HEPES | Thermo Fisher Scientific | Cat# 11330057 |
| Horse Serum, New Zealand origin | Thermo Scientific | Cat# 16050122 |
| Hydrocortisone | Sigma-Aldrich | Cat# H4001 |
| FiuoroBrite DMEM | Fisher | Cat# A18967–01 |
| Gibco EGF Recombinant Human Protein | Thermo Fisher Scientific | Cat# PHG0313 |
| Ham’s F12 phenol red | Sigma Alridch | Cat# N6658 |
| Cholera Toxin | Sigma-Aldrich | Cat# C8052 |
| Pen/Strep | Gibco | Cat# 15140–122 |
| 0.05% Trypsin-EDTA(1X) | Gibco | Cat# 25300–120 |
| Hoechst 33258 | Sigma-Aldrich | Cat# 861405 |
|
| ||
| Critical commercial assays | ||
|
| ||
| Annexin V Conjugates for apoptosis detection | ThermoFisher | Cat# A23204 |
| CellTiter-Glo® 2.0 Cell Viability Assay | Promega | Cat# G9241 |
| Amersham ECL Prime Western Blotting Detection Reagent | GE Heaithcare | Cat# RPN2232 |
| Pierce™ BCA Protein Assay Kit | Thermo | Cat# S-11791 |
|
| ||
| Experimentai modeis: Cell lines | ||
|
| ||
| Human: MCF10a | ATCC | Cat# CRL-10317; RRID:CVCL_0598 |
| Human: MCF10a + PB-NES ZapCV2 and | Lo. et ai.10; | N/A |
| PB-H2B- mCherry (stable) | PMID: 32014109 | |
| Human: MCF10a + PB-NLS ZapCV2 and PB-H2B- mCherry (stable) | This paper | N/A |
| Human: MCF10a + PB-NES ZapCV2 and PB-H2B-HaloTag + Scrambled mtfl- mCherry (stable) | This paper | N/A |
| Human: MCF10a + PB-NLS Zinc-dead and PB-H2B- mCherry (stable) | This paper | N/A |
| Human: MCF10a + PB-NES Zinc-dead and PB-H2B- mCherry (stable) | This paper | N/A |
| Human: MCF10a + PB-NES ZapCV2 and PB-H2B-HaloTag + shRNA mtfl knockdown-mCherry (stable) | This paper | N/A |
| Human: MCF10a + PB-NES ZapCV2 and PB-H2B-HaloTag + CSII-EF-DHB-mCherry | This paper | N/A |
|
| ||
| Recombinant DNA | ||
|
| ||
| Plasmid: PB-H2B-HaloTag (used for stable cell line generation) | Grimm et al.51; PMID: 28869757 | N/A |
| Plasmid: PB-H2B-mCherry (used for stable cell line generation) | Published in previous Palmer lab paper; PMID: 32014109 | N/A |
| Plasmid: PB-NES-ZapCV2 (used for stable cell line generation) | Published in previous Palmer lab paper; PMID:27959493 | N/A |
| Plasmid: PB-NLS-ZapCV2 (used for stable cell line generation) | This paper | Nuclear FRET sensor in Piggybac vector; NES sequence was replaced by NLS sequence; Submitted to Addgene |
| Plasmid: PB-NES-Zinc-dead (used for stable cell line generation) | This paper | Nuclear Zinc dead sensor in Piggybac vector; Zinc binding sequence is replaced by non-binding domain; Submitted to Addgene |
| Plasmid: PB-NLS-Zinc-dead (used for stable cell line generation) | This paper | Nuclear Zinc dead sensor in Piggybac vector; Zinc binding sequence is replaced by non-binding domain |
| Plasmid: MTF1.34 human shRNA (used for MTF-1 KD mCherry stable cell line generation) | This paper GeneCopoeia | HSH011543–34-LVRU6MP Plasmid containing shRNA targeted to MTF-1 gene; Target sequence: CCAACTCTGTCCTAACTAATA; Submitted to Addgene |
| Plasmid: Used for MTF-1 Scrambled - mCherry stable cell line generation | This paper GeneCopoeia | CSHCTR001-LVRU6MP Plasmid containing non-specific scrambled shRNA; Target sequence: N/A |
| Plasmid: CSII-EF-DHB-mCherry | Laboratory of Sabrina Spencer, CU Boulder | CDK2 kinase translocation Sensor |
|
| ||
| Software and algorithms | ||
|
| ||
| BD FACSDiva Version 8 | BD Biosciences | N/A |
| Adobe Illustrator CS | Adobe | N/A |
| MATLAB 2017a and VR2020b | Mathworks | N/A |
| Prism Version 9.2.0 | GraphPad | N/A |
| Cell segmentation and tracking pipeline | Elliptrack36 | PMID: 32755578 |
| Live-cell analysis pipeline | live-cell-zinc-sensor | https://doi.org/10.5281/zenodo.7968726 |