Key Resources Table
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| anti-HA, mouse monoclonal | BioLegend | #901501 |
| anti-GABA, rabbit polyclonal | Thermo Fisher | #PA5-32241 |
| anti-Lamp1, rat monoclonal | Santa Cruz | #sc-19992 |
| anti-LAMP1, mouse monoclonal | Santa Cruz | #sc20011 |
| anti-LAMP1, rabbit monoclonal | Cell Signaling Technologies | #9091S |
| anti-LGALS3BP, rabbit polyclonal | Thermo Fisher | #10281-1-AP |
| anti-Phospho-Tau-Ser202/Thr205, rabbit polyclonal | ABclonal | #AP0894 |
| anti-TMED5, rabbit polyclonal | Thermo Fisher | #PA5-141055 |
| anti-TuJ, mouse monoclonal | Promega | #G712A |
| anti-Mouse IgG, goat polyclonal, Alexa488-conjugated | Thermo Fisher | #A11001 |
| anti-Rabbit IgG, donkey polyclonal, Alexa488-conjugated | Thermo Fisher | #A21206 |
| anti-Rat IgG, rabbit polyclonal, Fluorescein-conjugated | Vector | #FI-4000 |
| anti-Mouse IgG, donkey polyclonal, Alexa555-conjugated | Thermo Fisher | #A31570 |
| anti-Rabbit IgG, goat polyclonal, Alexa555-conjugated | Thermo Fisher | #A21428 |
| anti-HA magnetic beads | Thermo Fisher | #88837 |
| anti-GFP Trap beads | Chromotek | #GTMA-10 |
| Chemicals, peptides, and recombinant proteins | ||
| MEM, GlutaMAX™ Supplement | Thermo Fisher | #41090-036 |
| Fetal Bovine Serum | Thermo Fisher | #A31605-02 |
| Non-Essential Amino Acids | Thermo Fisher | #11140050 |
| Sodium Pyruvate | Thermo Fisher | #11360070 |
| Accutase | Fisher Scientific | #NC9839010 |
| Lipofectamine 2000 | Thermo Fisher | #11668019 |
| OptiMEM Reduced Serum Medium | Thermo Fisher | #31985062 |
| Lipofectamine RNAi Max | Thermo Fisher | #13778150 |
| Poly-L-Lysine Solution | Sigma Aldrich | #P4707 |
| Phosphate-Buffered Saline | Corning | #21-030-CV |
| Paraformaldehyde | Sigma Aldrich | #F8775 |
| Hoechst 33342 | Thermo Fisher | #H3570 |
| CytoSeal™ 60 | VWR | #8310-4 |
| Lysotracker Red DND-99 | Thermo Fisher | #L7528 |
| CellMask™ Deep Red Plasma Membrane Stain | Thermo Fisher | #C10046 |
| OregonGreen™, Dextran 70,000 MW | Thermo Fisher | #D7172 |
| Dimethyl Sulfoxide | Sigma Aldrich | #D2650 |
| Bafilomycin A1 | Fisher Scientific | #AAJ61835MCR |
| Gly-Phe-p-naphthylamide | Cayman | #14634 |
| Ionomycin | Cayman | #10004974 |
| Carbonyl cyanide 4-(trifluoromethoxy)phenylhydrazone (FCCP) | Sigma Aldrich | #SML2959 |
| Penicillin-Streptomycin | Corning | #30-002-CI |
| DMEM, 4.5 g/L glucose, L-glutamine | Corning | #10-017-CV |
| PolyJet In Vitro DNA Transfection Reagent | SignaGen | #SL100688 |
| Polybrene | Millipore | #TR-1003-G |
| Puromycin | Thermo Fisher | #A1113802 |
| Matrigel | Corning | #354277 |
| mTESR Plus Media | StemCell Technologies | #100-0274 |
| Y-27632 ROCK inhibitor | Tocris | #1254 |
| DMEM, 4.5 g/L glucose, GlutaMAX | Thermo Fisher | #10-566-024 |
| KnockOut Serum Replacement | Thermo Fisher | #10828028 |
| SB-431542 | Stemgent | #04-0010-10 |
| LDN-193189 | Stemgent | #04-0074 |
| InSolution Wnt Agonist IWP2 | Millipore | #506072 |
| InSolution Smoothened Agonist SAG | Millipore | #566661 |
| FGF8 | Peprotech | #100-25 |
| Laminin, natural mouse protein | Thermo Fisher | #23017-015 |
| DMEM/F12 | Thermo Fisher | #11330-032 |
| N2 Supplement | Thermo Fisher | #17502-048 |
| Neurobasal | Thermo Fisher | #21103-049 |
| B27 Supplement | Thermo Fisher | #17504-044 |
| BDNF | Peprotech | #450-02 |
| GDNF | Peprotech | #450-10 |
| Critical commercial assays | ||
| NEBuilder HiFi DNA Assembly Master Mix | New England Biolabs | #E2621L |
| RNeasy Mini Kit | Qiagen | #74106 |
| Superscript IV Kit | Thermo Fisher | #18090010 |
| Power SYBR Green PCR Master Mix | Thermo Fisher | #4367659 |
| TaqMan™ Fast Advanced Master Mix for qPCR | Thermo Fisher | #4444963 |
| Intracellular pH Calibration Buffer Kit | Thermo Fisher | #P35379 |
| Duolink® In Situ Red Starter Kit Mouse/Rabbit | Millipore | #DUO92101 |
| Deposited data | ||
| Proteomic raw and processed data | This Paper | PRIDE ProteomeXchange Consortium: PXD044942; Tables S2–S3 |
| Experimental models: Cell lines | ||
| Neuro-2a neuroblastoma cells | Harris et al., 200482 | N/A |
| Neuro-2a neuroblastoma cells, apoE3-humanized | Harris et al., 200482 | N/A |
| Neuro-2a neuroblastoma cells, apoE4-humanized | Harris et al., 200482 | N/A |
| Neuro-2a neuroblastoma cells, TMEM192-3xHA tag | This paper | N/A |
| Neuro-2a neuroblastoma cells, apoE3-humanized, TMEM192-3xHA tag | This paper | N/A |
| Neuro-2a neuroblastoma cells, apoE4-humanized, TMEM192-3xHA tag | This paper | N/A |
| Skin-derived human iPSCs, isogenic apoE3/apoE3 | Wang et al., 201821 | N/A |
| Skin-derived human iPSCs, isogenic apoE4/apoE4 | Wang et al., 201821 | N/A |
| Oligonucleotides | ||
| Lgals3bp forward primer, insert into pEGFP-N3: caagcttcgaattcagggacATGGCTCTCCTGTGGCTC | This paper | N/A |
| Lgals3bp reverse primer, insert into pEGFP-N3: cctgtggagccggtggagccCACCATGTCAGTGGAGTTAG | This paper | N/A |
| pEGFP-N3 forward primer: GGCTCCACCGGCTCCACA | This paper | N/A |
| pEGFP-N3 reverse primer: GTCCCTGAATTCGAAGCTTGAGCTC | This paper | N/A |
| qPCR assay: App | Thermo Fisher | #Mm01344172_m1 |
| qPCR assay: Hprt | Thermo Fisher | #Mm01545399_m1 |
| qPCR assay: Lgals3bp | Thermo Fisher | #Mm00478303_m1 |
| qPCR assay: Mapt | Thermo Fisher | #Mm00521988_m1 |
| qPCR assay: Psen2 | Thermo Fisher | #Mm00448405_m1 |
| qPCR assay: Tmed5 | Thermo Fisher | #Mm00547008_m1 |
| siRNA: APOE | Thermo Fisher | #AM16708_41598 |
| siRNA: App | Thermo Fisher | #s62516 |
| siRNA: Lgals3bp | Thermo Fisher | #AM16708_162469 |
| siRNA: Mapt | Thermo Fisher | #s70123 |
| siRNA: Psen2 | Thermo Fisher | #AM16708_68876 |
| siRNA: Scramble control | Thermo Fisher | #4390844 |
| siRNA: Tmed5 | Thermo Fisher | #AM16703_83238 |
| Recombinant DNA | ||
| Plasmid: LAMP2-GCaMP6s | Li et al., 201959 | Addgene #154151 |
| Plasmid: pA-NRF Gag-Pol-Tat-Rev | Bouhaddou et al., 2020113 | pJH-045 |
| Plasmid: pMD2.G VSV-G | Bouhaddou et al., 2020113 | pJH-046 |
| Plasmid: pLJC5-TMEM192-3xHA | Abu-Remaileh et al., 201761 | Addgene #102930 |
| Plasmid: pCAGGS mitoKeima | Li et al., 2021114 | N/A |
| Plasmid: Lgals3bp-GFP | This paper | N/A |
| Plasmid: LAMP1-mGFP | Falcon-Perez et al., 2005115 | Addgene #34831 |
| Software and algorithms | ||
| ClueGO | Bindea et al., 2009116 | https://apps.cytoscape.org/apps/cluego |
| Cytoscape | Shannon et al., 2003117 | https://cytoscape.org |
| ImageJ/Fiji | Schindelin et al., 2012118 | https://imagej.net |
| MaxQuant | Cox and Mann, 2008119 | https://www.maxquant.org |
| RStudio | RStudio: Integrated Development for R. RStudio | http://www.rstudio.com |
| Other | ||
| Micro Slides | VWR | #48311-307 |
| ibiTreat ibidi 8-well Live-cell Imaging Chambers | ibidi | #80806 |