KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Rabbit anti-Evi1/Mecom | Cell signaling | RRID:AB_2184098 |
| Chicken and rabbit anti-GFP | Invitrogen | RRID:AB_2534023 |
| Guinea-pig anti-zebrafish Prdm16/Mecom antibody | Covance | N/A |
| Rabbit anti-zebrafish Mecom antibody | Covance | N/A |
| Mouse anti-Hb9 antibody | Invitrogen | RRID:AB_2540929 |
| Chemicals, peptides, and recombinant proteins | ||
| Tween | Fisher Scientific | BP337-100 |
| Triton | Sigma Aldrich | T8787-100ML |
| MS-222 | Sigma Aldrich | E10521 |
| 32% PFA | Electron Microscopy Sciences | 15714 |
| Proteinase K | ThermoFisher Scientific | 25530049 |
| BSA | ThermoFisher Scientific | 50-253-966 |
| Papain | Worthington Biochemical | LK003150 |
| HBSS | ThermoFisher Scientific | 14-170-112 |
| EBSS | ThermoFisher Scientific | 24010043 |
| DNase | Worthington Biochemical | LK003172 |
| DAPI | Sigma Aldrich | D9542-10mg |
| Critical commercial assays | ||
| Digoxigenin-dUTP labeling kit | Roche | N/A |
| in situ hybridization chain reaction v3.0 (HCR) | Molecular Instruments | N/A |
| DreamTaq Green PCR Master Mix (2X) | Thermo Scientific | K1082 |
| Deposited data | ||
| RNA-seq of WT zebrafish MNS at 1 dpf and 1.5 dpf | Scott et al.39 | GEO: GSE173350 |
| Raw and analyzed 10x Genomics scRNA-seq datasets | This paper | GEO: GSE240026 |
| Experimental models: Organisms/strains | ||
| Zebrafish: Tg(olig2:dsRed2)vu19 | Kucenas et al.38 | N/A |
| Zebrafish: Tg(prdm16:GAL4) | NBRP | gSAIzGFFM1116A |
| Zebrafish: Tg(olig2:GFP) | Scott et al.85 | N/A |
| Zebrafish: mecomnyc41 | This paper | N/A |
| Zebrafish: prdm16nyc142 | This paper | N/A |
| Zebrafish: Tg(prdm16:GAL4); prdm16nyc584 | This paper | N/A |
| WT Mice: mixed genetic background | New York University Grossman School of Medicine Animal Facilities | N/A |
| Leucoraja erinacea embryos | Marine Resources Department of MBL | N/A |
| Specific Pathogen Free Fertile Chicken Eggs | AVS bio | N/A |
| Oligonucleotides | ||
| Prdm16 d17/d22 forward primer (CCATTAAAGCCATTGCCTCC) |
GeneWiz | N/A |
| Prdm16 d17/d22 reverse primer (GAACATGCCAGGATTGAGTG) |
GeneWiz | N/A |
| Mecom d25 forward primer (CCGCTGGAGGGTTGTTTGC) |
GeneWiz | N/A |
| Mecom d25 reverse primer (CCGATGGTAAAGTCCTGATGG) |
GeneWiz | N/A |
| Prdm16 gal4 forward primer (CCGTGACTGATCGCCTGGCAAG) |
GeneWiz | N/A |
| Prdm16 gal4 reverse primer (GCCGGGCAGCATATCCAGATCG) |
GeneWiz | N/A |
| HCR probes | Molecular Instruments | N/A |
| Recombinant DNA | ||
| 5UAS zfSynaptophysin:GFP-5UAS DsRedExpress | Addgene | RRID:Addgene_74317 |
| Software and algorithms | ||
| ImageJ | Schindelin et al.86 | https://imagej.nih.gov/ij/ |
| Imaris (Bitplane) | Oxford Instruments | https://imaris.oxinst.com/ |
| Python v3 | Python Software Foundation | https://www.python.org |
| Prism v9 | GraphPad | https://www.graphpad.com/features |
| Seurat v4 | Hao et al.87 | https://satijalab.org/seurat/ |
| Velocyto v0.17.17 | Manno et al.40 | https://velocyto.org/velocyto.py/ |
| CellRanger v3.0.2 | Zheng et al.88 | https://support.10xgenomics.com/single-cell-gene-expression/software/overview/welcome |
| LabVIEW | National Instruments Corporation | https://www.ni.com/en-us/shop/software/products/labview.html |
| CHOPCHOP online tool | Labun et al.89 | https://chopchop.cbu.uib.no/ |
| Other | ||
| Glass cuvettes | Starna Cells Inc. | (93/G.10 55 × 55 × 10mm) |
| Digital CMOS cameras | FLIR Systems | Blackfly PGE-23S6M |
| 5W 940nm infrared LED back light | eBay | N/A |
| Infrared filter | Edmund Optics | 43–953 |
| Aspheric condenser lens with diffuser | Thor Labs | ACL5040-DG15-B |