Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
| Oligonucleotide | Sequence 5′-3′ | Description |
|---|---|---|
| pET28a(+)-PfThrRS-Fwd | TGGTGCCGCGCGGCAGCC̲A̲T̲A̲T̲G̲CCAACTATTACTCTACCC | Designed to clone entire PCS of PfThrRS as a NdeI-XhoI fragment into pET28a(+) using Gibson assembly |
| pET28a(+)-PfThrRS-Rev | CAGTGGTGGTGGTGGTGGTGC̲T̲C̲G̲A̲G̲TTACTCCGAATCTGGGCG |
