Abstract
Ganoderma lucidum polysaccharide is the most widely used complementary therapy in cancer. The present study aims to investigate the possible interaction between Ganoderma lucidum polysaccharide and Docetaxel (a chemotherapy drug) and the first-line medication for prostate cancer treatment (Flutamide) and sensitizing the cells to these treatments. The cytotoxic effects of Ganoderma lucidum polysaccharide in combination with Docetaxel and Flutamide on prostate cancer cells were investigated by the MTT test, Hoechst staining, and flow cytometry. In addition, the expression of genes related to apoptosis, angiogenesis, Epithelial-Mesenchymal Transition pathway (EMT), and prostate cancer biomarkers by Real-Time PCR was investigated. The results demonstrated that IC50 values for Ganoderma lucidum polysaccharide (30 μM and 20 μM), Docetaxel (10 μM and 5 μM), and Flutamide (20 μM and 12 μM) with MTT were confirmed by flow cytometry in a dose and time-dependent manner. Regarding the high efficacy of Ganoderma lucidum polysaccharide in combination with Flutamide and Docetaxel, 10 μM and 5 μM Flutamide were used instead of 20 μM and 12 μM and 5 μM and 2 μM Docetaxel was used instead of 10 μM and 5 μM in PC3 and LNCap, respectively. Moreover, for the first time, it was shown that Ganoderma lucidum polysaccharide alone and in combination with Docetaxel and Flutamide significantly augmented apoptosis, reduced cell migration and colonization, and downregulated expression of KLK2 and EMT pathway genes in both PC3 and LNCap cell line (P < 0.01). Ganoderma lucidum polysaccharide synergistically increased the effect of Docetaxel and Flutamide and increased the sensitivity of the prostate cancer cell lines to these drugs. Therefore, it may provide a new therapeutic strategy against prostate cancer.
Subject terms: Cancer, Urology
Introduction
Prostate cancer (PCa), the most important type of male malignancy, is ranked the second most common cancer globally. American Cancer Society estimates approximately 288,300 new prostate cancer cases and 34,700 deaths from prostate cancer in 20231.
Despite significant advances in the treatment of cancers in the last decade, the treatment of advanced cancer is still challenging, and there is a need for more effective treatments with fewer side effects2. Medicinal plants have long been used as a natural remedy by ancient people. The main reason for using herbal medicines is that they might not have the side effects and complications caused by chemotherapy and radiotherapy. Recently, many studies have suggested the effectiveness of Ganoderma lucidum polysaccharide in the treatment of various cancers, such as breast, stomach, prostate, ovary, cervix, and liver3–8, by inhibiting tumor growth and inducing apoptosis9–11.
However, whether Ganoderma lucidum polysaccharide can enhance the antitumor effect of Flutamide (first-line prostate cancer drug) and Docetaxel (a chemotherapy drug with high side effects) in prostate cancer, requiring lower doses for treatment with improved side effects is yet to be identified. Therefore, in this project, an attempt was made to investigate the effect of Ganoderma lucidum polysaccharide in preventing the growth of prostate cancer cells, sensitizing the cells to Flutamide and Docetaxel, and reducing their side effects. To this end, apoptosis, migration, colonization, and expression changes on the EMT pathway, angiogenesis, and prostate cancer biomarkers were investigated.
Materials and methods
Cell lines and cell culture
PC3 (ATCC Number: CRL-1435, NCBI Code: C427) and LNCaP (ATCC Number: CRL-10995, NCBI Code: C439) cell lines were purchased from the Pasteur Institute of Iran. The prostate cancer cells were cultured in DMEM medium (Gibco) supplemented with 10% heat-inactivated fetal bovine serum (FBS, Gibco), 1000 units/ml Penicillin, and 100 μg/ml streptomycin (Gibco BRL). LNCap and PC3 cells were incubated in a humid atmosphere with 5% CO2 at 37 °C overnight. The drugs used in this study included 2-Methyl-N-[4-Nitro-3-(trifluoromethyl) Phenyl] Propanamide with CAS Number 13311-84-7 (Flutamide), Ganoderma lucidum polysaccharide extract (CAS Number: 223751-82-4), and Docetaxel (CAS Number: 114977-28-5) all purchased from the Sigma-Aldrich (Sigma-Aldrich). To prepare stock for treating cell lines, Flutamide and Docetwerel were dissolved in DMSO (Sigma-Aldrich). DMEM medium with 0.1% DMSO was used as a control.
Determining the survival of prostate cancer cells
Estimating cell survival in cancer studies is essential to determine cell sensitivity and treatment outcome. Three Standard colorimetric methods were used to determine the cancer cell lines' survival: (1) Trypan blue, (2) Microculture Tetrazolium, and (3) Colony formation assays.
Trypan blue dye
The trypan blue staining test was used to stain dead cells with damaged membranes visible in blue. The cell survival percentage was calculated as ((Total cell count—stained cells)/Total cell count)) × 100. The cured prostate cancer cells with Flutamide, Ganoderma lucidum polysaccharide, and Docetaxel were centrifuged and re-suspended with PBS solution (100 µL). An equal amount of cell suspension and trypan blue dye 0.4% were mixed. Finally, they were placed on the Neubauer slide and counted.
Microculture tetrazolium test (MTT)
The inhibitory concentration of 50% (IC50) and inhibitory effects of Flutamide, Ganoderma lucidum polysaccharide, and Docetaxel on PC3 and LNCap metabolic activity were examined by MTT Assay (Sigma-Aldrich). For this purpose, 4.5 × 103/mL per well cells were seeded (96-well plates, 24–72 h) with Flutamide, Ganoderma lucidum polysaccharide, Docetaxel, and their combinations in various concentrations. MTT solution (0.5 mg/mL) was added to the cells and incubated for 4 h at 37 °C. The formed formazan crystals were dissolved in dimethyl sulfoxide (DMSO) until a colored solution was obtained. Optical density (OD) was read at 570 nm wavelength with an ELISA microplate reader. Dose and Time response curves were plotted and calculated by GraphPad PRISM software version 9 (San Diego, CA).
In vitro 3D colony formation assay
The number of cancer cell colonies after treatment is evaluated as cell survival. A colony formation test was used to assess the aggressiveness of cancer cells after treatment. Growing PC3 and LNCaP cell lines were trypsinized and plated with 0.7% agarose at 1.5 × 103 cells per well of a six-well plate coated with 2% agarose. After 48 h of treatment, the drug was removed, and the cells were treated with a culture medium for 14 days. Next, the number of colonies in each well was counted. Five random view fields of microscopic from each well were selected and the colonies were counted and averaged. If the number of accumulated cells is 50 or more, it is considered a colony; otherwise, it is considered a cluster. Colony size was distinctive using Image J software. All experiments were performed independently in triplicate.
Hoechst dye (33,342) staining
Hoechst dye assay was carried out to evaluate the apoptosis of cancer cell lines. The prostate cancer cell lines were seeded into a 96-well plate (2.5 × 103 cells/well). Afterward, they were treated with Flutamide, Docetaxel, Ganoderma lucidum polysaccharide, and their combinations. After 48 h, cells were fixed with cold Paraformaldehyde (100 μL) and washed twice with PBS (100 μL). Next, 2 μL Hoechst dye was added to the cell precipitate and incubated at 25 °C in the dark. The plate was observed and imaged 30 min later with a fluorescence microscope at 100× magnification which identifies nuclear condensation and measured the number of fragmented nuclei in intact cells. Fragmented nuclei in some cells indicate apoptosis.
Measurement of cell migration
The prostate cancer cell lines were seeded at 3.5 × 105 cells per well in a 6-cell culture dish. A vertical line was created along the diameter of these 6 cells with a sampler tip and treated with Flutamide, Docetaxel, Ganoderma lucidum polysaccharide treatment, PC3 cell (20 μM Flutamide/10 μM Docetaxel/30 μM Ganoderma lucidum polysaccharide), and LNCaP cell (12 μM Flutamide/5 μM Docetaxel/ 20 μM Ganoderma lucidum polysaccharide). Then, photography was done at 0 and 48 h. The cell migration rate was calculated by Image J software based on the distance between the two edges of the scratch in the control and treated groups.
Measurement of cell apoptosis by flow cytometry
Annexin-V-Fluos staining assay containing V-FITC (fluorescein isothiocyanate) and PI dye (propidium iodide) was carried out to identify cells in four states of live, early apoptosis, late apoptosis, and necrosis. About 1 × 105 cells/ml were seeded in a 6-well plate. The cells were washed with PBS twice and suspended with PI and Annexin-v for 48 h after treatment with Flutamide, Ganoderma lucidum polysaccharide, and Docetaxel and their combination. Cells were incubated in the dark for 15 min at 37 °C and investigated with flow cytometry. Annexin-V-Fluos-positive and PI-negative indicate early apoptosis, while Annexin-V-Fluos-positive and PI-positive show late apoptosis12.
DNA cell cycle analysis
About 6 × 105 cells/well were treated with Flutamide, Ganoderma lucidum polysaccharide, and Docetaxel for 48 h, washed with PBS, and fixed with 70% cold ethanol for 24 h. Then, control and treated cells were incubated (37 ℃ for 30 min) with RNase I and dye DNA with propidium iodide (PI) (500 μL). Finally, cells were detached by BD flow cytometer set and executed with the Flowjo software (Tree Star Inc, version 9.6.3). According to PI staining, the sub-G1 pattern is identified as apoptotic cells.
RNA extraction, cDNA synthesis, and gene expression analysis by real-time PCR
TriPure Isolation Reagent was carried out to extract the cell’s RNA according to the manufacturer’s instructions. The quantity of RNA concentration was measured using a Colibri Microvolume Spectrometer (Titertek-Berthold). Next, cDNA from RNA was generated using Easy™ cDNA Synthesis Kit (Pars Toos. Co., Iran). QIAGEN real-time PCR, Rotor-Gene Q instrument, and 2-ΔΔCT method were employed to investigate the relative expression of desired genes. Primers were certified by Primer-BLAST online software (NCBI website) and shown in Table 1.
Table 1.
Nucleotide sequences of specific primers.
| Gene | Accession number | Forward and Reverse primers (5′-3′) | Size (bp) |
|---|---|---|---|
| OPN-a | NM_001040058.1 | ATCTCCTAGCCCCACAGAAT | 208 |
| CATCAGACTGGTGAGAATCATC | |||
| OPN-b | NM_000582.2 | ATCTCCTAGCCCCAGAGAC | 209 |
| AAAATCAGTGACCAGTTCATCAG | |||
| OPN-c | NM_001040060.1 | TGAGGAAAAGCAGAATGCTG | 155 |
| GTCAATGGAGTCCTGGCTGT | |||
| VEGF-C | NM_005429.4 | GTCTGTGTCCAGTGTAGATG | 360 |
| AGGTAGCTCGTGCTGGTGTT | |||
| KLK2 | NM_005551 | TCAAGGGTGAGCCCTTTACT | 100 |
| ATCCTCTCCCTTTCC CTCAT | |||
| E-cadherin | NM_004360 | GAATGACAACAAG CCCGAAT | 150 |
| TTTGTCAGGGAGCTCAGGAT | |||
| SNAIL | NM_005985 | TGCCCTCAAGATGCACATCCGA | 203 |
| GGGACAGGAGAAGGGCTTCTC | |||
| GAPDH | NM-001289746.1 | GTGAACCATGAGAAGTATGACCAAC | 123 |
| CATGAGTCCTTC CACGATACC |
Statistical analysis
All data were expressed as means ± standard deviation (SD) of triplicate determinants. Analysis of T-tests was used to evaluate the results. Statistical significance was defined at *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001 compared to the corresponding control.
The Ethics approval
This is an in vitro project on Sensitizing Prostate Cancer Cells and has no ethical code.
Results
Cell morphology changes after treatment
Reviewing cell morphology is very important to understand cell behavior. After treating cells with three drugs and their combination, it was observed that the cells became more elongated, smaller, and wrinkled, and the number of living cells decreased (Fig. 1).
Figure 1.
Estimation of cell morphology of both prostate cancer cell lines (PC3 and LNCap). Untreated PC3 and LNCap cells were treated with Flutamide (Flu), Docetaxel (Doc), Ganoderma lucidum polysaccharide (GLP), and their combination. Cell deformation, growth inhibition, loss of cellular appendages and adhesion, and cell morphology changes in cells at different treatments after incubation were seen.
Flutamide, Docetaxel, and Ganoderma lucidum polysaccharide inhibit cell proliferation and Ganoderma lucidum polysaccharide sensitizes both prostate cancer cells to Flutamide and Docetaxel
The Flutamide cytotoxic effects (0–35 μM), Docetaxel (0–10 μM), and Ganoderma lucidum polysaccharide (0–50 μM) alone and in combination were assessed in PC3 and LNCap prostate cancer cell lines. Growth inhibitory effects of different concentrations of Flutamide, Docetaxel, and Ganoderma lucidum polysaccharide or their combination were estimated by MTT assay for 24, 48, and 72 h. Based on the results, IC50 values were 20 and 12 μM for Flutamide; 10 and 5 μM for Docetaxel, and 30 and 20 μM for Ganoderma lucidum polysaccharide for PC3 and LNCaP cells, respectively. The IC50 values for the combination of Flutamide plus Ganoderma lucidum polysaccharide were 10 and 30 μM instead of 20 and 30 μM and 5 and 20 μM instead of 12 and 20 μM for PC3 and LNCaP cells, respectively. Also, these values were 10 and 10 μM instead of 20 and 10 μM 5 and 5 μM instead of 12 and 5 μM for a combination of Flutamide plus Docetaxel, for PC3 and LNCap, respectively. The results revealed that Flutamide, Docetaxel, and Ganoderma lucidum polysaccharide alone and in combination had a significant cytotoxic effect on both PC3 and LNCaP cell lines in a dose- and time-dependent manner, thereby effectively reducing their viability (Fig. 2 and Table 2).
Figure 2.
The effect of Flutamide, Docetaxel, and Ganoderma lucidum polysaccharide with different concentrations (0–50 µM) on PC3 and LNCap cell proliferation. The anti-growth effect of Ganoderma lucidum polysaccharide (A), Flutamide (B), Docetaxel (C) after 1,2 and 3 days and their combination on LNCaP (D) and PC3 (E) cell lines was measured by MTT assay after 2 days. MTT assays are obtainable as the mean ± SD of three independent experiments. Statistical significance was defined at *p < 0.05, **p < 0.01, and ***p < 0.001 compared to the corresponding control.
Table 2.
The information obtained from the MTT assay on the proliferation and cell viability of prostate cancer cell lines treated with three drugs Ganoderma lucidum polysaccharide, flutamide and docetaxel (0–50 μM) for 24, 48 and 72 h.
| Time | Cell line/Drug/Dose | 5 µM | 10 µM | 15 µM | 20 µM | 25 µM | 30 µM | 35 µM | 40 µM | 45 µM | 50 µM |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Cells treated for 24 h | LNCaP + GLP | 99.3 ± 2.3 | 89.12 ± 2.7 | 80.12 ± 2.6 | 73.11 ± 1.7 | 65.4 ± 1.01 | 60.1 ± 3.5 | 51.14 ± 3.1 | 48 ± 2.3 | 35.11 ± 1.6 | 28.45 ± 1.5 |
| PC3 + GLP | 99.4 ± 3.1 | 95 ± 2.2 | 91.2 ± 3.4 | 88.47 ± 1.4 | 78.303 ± 2.5 | 72.95 ± 3.2 | 66 ± 1.1 | 53.289 ± 4.1 | 49.145 ± 2.1 | 46 ± 1.7 | |
| 1 µM | 2 µM | 3 µM | 4 µM | 5 µM | 6 µM | 7 µM | 8 µM | 9 µM | 10 µM | ||
| LNCaP + Docetaxel | 89.01 ± 1.1 | 85.31 ± 1.4 | 80.32 ± 3.5 | 75.25 ± 2.8 | 73.12 ± 1.5 | 69.36 ± 1.6 | 67.22 ± 3.5 | 64.3 ± 2.7 | 62.1 ± 1.1 | 59 ± 3.5 | |
| PC3 + Docetaxel | 98 ± 1.1 | 96 ± 2.6 | 95 ± 1.4 | 91 ± 1.1 | 86.12 ± 1.7 | 81.32 ± 1.8 | 78.22 ± 2.5 | 72.11 ± 1.6 | 69.02 ± 1.01 | 68 ± 1.4 | |
| 1 µM | 2.5 µM | 5 µM | 10 µM | 12 µM | 15 µM | 20 µM | 25 µM | 30 µM | 35 µM | ||
| LNCaP + Flutamide | 99.35 | 89.67 ± 2.6 | 78.95 ± 1.7 | 75.12 ± 3.1 | 65.47 ± 1.1 | 60.58 ± 1.6 | 58.76 ± 1.4 | 56.24 ± 2.6 | 54.32 ± 2.6 | 51.78 ± 1.3 | |
| PC3 + Flutamide | 99.42 ± 1.5 | 96.28 ± 1.4 | 87.61 ± 2.3 | 79.85 ± 1.1 | 70.25 ± 2.3 | 62.31 ± 1.7 | 59.43 ± 1.6 | 54.87 ± 1.7 | 51.77 ± 1.4 | 48.24 ± 2.6 | |
| 5 µM | 10 µM | 15 µM | 20 µM | 25 µM | 30 µM | 35 µM | 40 µM | 45 µM | 50 µM | ||
| Cells treated for 48 h | LNCaP + GLP | 91.7 ± 2.6 | 79.09 ± 1.1 | 67.63 ± 1.3 | 53.34 ± 2.6 | 42.9 ± 1.4 | 38.36 ± 2.6 | 31.12 ± 1.7 | 28 ± 2.6 | 25.07 ± 2.3 | 18.7 ± 1.6 |
| PC3 + GLP | 97.3 ± 1.6 | 92 ± 1.7 | 85.12 ± 2.6 | 79.001 ± 1.4 | 68.132 ± 2.6 | 52.878 ± 1.4 | 46 ± 2.3 | 43.777 ± 1.1 | 35.322 ± 1.3 | 30 ± 1.1 | |
| 1 µM | 2 µM | 3 µM | 4 µM | 5 µM | 6 µM | 7 µM | 8 µM | 9 µM | 10 µM | ||
| LNCaP + Docetaxel | 85.31 ± 1.5 | 72.33 ± 1.7 | 65.02 ± 1.1 | 59.35 ± 1.4 | 48.65 ± 2.6 | 41.09 ± 1.3 | 38.114 ± 1.7 | 31.51 ± 1.3 | 28.16 ± 2.6 | 21.03 ± 2.2 | |
| PC3 + Docetaxel | 90.21 ± 1.7 | 85 ± 1.4 | 79.02 ± 2.6 | 75 ± 1.7 | 72 ± 2.6 | 68 ± 1.4 | 64 ± 1.1 | 57.03 ± 1.5 | 55.12 ± 3.1 | 48 ± 1.1 | |
| 1 µM | 2.5 µM | 5 µM | 10 µM | 12 µM | 15 µM | 20 µM | 25 µM | 30 µM | 35 µM | ||
| LNCaP + Flutamide | 98.6843 ± 1.01 | 86.36454 ± 1.5 | 71.8637 ± 1.1 | 68.014 ± 1.3 | 53.87 ± 1.7 | 49.7578 ± 1.5 | 48.812 ± 1.4 | 41.043 ± 2.6 | 38.65 ± 1.7 | 34.18 ± 1.7 | |
| PC3 + Flutamide | 97.089 ± 1.1 | 88.293 ± 1.4 | 76.918 ± 2.6 | 69.99 ± 2.6 | 67.94 ± 1.1 | 59.721 ± 1.7 | 51.223 ± 3.1 | 47.037 ± 1.4 | 28.99 ± 1.3 | 20.803 ± 1.1 | |
| 5 µM | 10 µM | 15 µM | 20 µM | 25 µM | 30 µM | 35 µM | 40 µM | 45 µM | 50 µM | ||
| Cells treated for 72 h | LNCaP + GLP | 91.7 ± 1.2 | 79.09 ± 1.6 | 67.63 ± 2.9 | 53.34 ± 3.9 | 42.9 ± 2.1 | 38.36 ± 3.5 | 31.12 ± 2.7 | 28 ± 2.3 | 25.07 ± 2.2 | 18.7 ± 3.4 |
| PC3 + GLP | 88 ± 1.9 | 79 ± 1.6 | 70 ± 1.4 | 61 ± 1.0 | 55 ± 2.1 | 42 ± 1.7 | 35 ± 1.3 | 29 ± 2.1 | 20 ± 1.3 | 13 ± 1.1 | |
| 1 µM | 2 µM | 3 µM | 4 µM | 5 µM | 6 µM | 7 µM | 8 µM | 9 µM | 10 µM | ||
| LNCaP + Docetaxel | 80.21 ± 2.7 | 70.14 ± 2.8 | 61.27 ± 2.6 | 54.39 ± 3.1 | 44.12 ± 1.1 | 31.38 ± 2.7 | 27.11 ± 1.6 | 23.73 ± 2.3 | 15.32 ± 1.7 | 10.63 ± 3.1 | |
| PC3 + Docetaxel | 75 ± 1.9 | 70.21 ± 1.1 | 61.31 ± 1.7 | 54.02 ± 1.9 | 41.25 ± 2.7 | 35.79 ± 1.8 | 20.91 ± 1.5 | 14.97 ± 2.6 | 9.67 ± 2.2 | 5.11 ± 1.3 | |
| 1 µM | 2.5 µM | 5 µM | 10 µM | 12 µM | 15 µM | 20 µM | 25 µM | 30 µM | 35 µM | ||
| LNCaP + Flutamide | 98.6843 ± 2.5 | 86.36454 ± 1.4 | 71.8637 ± 2.6 | 68.014 ± 1.7 | 53.87 ± 1.1 | 49.7578 ± 1.2 | 48.812 ± 1.4 | 41.043 ± 1.7 | 38.65 ± 3.1 | 34.18 ± 1.4 | |
| PC3 + Flutamide | 95.21 ± 1.4 | 86.34 ± 1.1 | 74.54 ± 2.6 | 66.35 ± 3.2 | 64.24 ± 1.4 | 53.41 | 46.25 ± 1.7 | 38.11 ± 2.6 | 25.38 ± 2.6 | 18.34 ± 1.1 |
Reduction in the colonies number by Flutamide, Docetaxel, and Ganoderma lucidum polysaccharide
The colony formation by untreated prostate cancer cells was proportional to the invasive potential of the prostate cell line. Untreated PC3 cells produced more colonies than the LNCap cell line. Flutamide, Docetaxel, and Ganoderma lucidum polysaccharide at concentrations of 20 μM and 12 μM, 10 μM and 5 μM, 30 μM, and 20 μM significantly inhibited the colony formation abilities of both cell lines PC3 and LNCap, respectively, compared to the level of colony formation in the untreated cell lines. Both cell lines treated with the combination of two drugs significantly suppressed the ability of colony formation. The results show the selective antitumor activity of Flutamide, Docetaxel, and Ganoderma lucidum polysaccharide on both prostate cancer cell lines (Fig. 3).
Figure 3.
Colony formation assay in PC3 and LNCap cell lines. Both Cell lines were treated with 20 μM and 12 μM, 10 μM and 5 μM, 30 μM and 20Μm of Flutamide, Docetaxel, and Ganoderma lucidum polysaccharide for PC3 and LNCap respectively at six-well plates then cultured for 12 days and stained with 0.5% crystal violet. Untreated PC3 and LNCap cells (A, B). Treated PC3 and LNCap cells with Flutamide (C, D), Treated cells with Docetaxel (E, F), Treated cells with Ganoderma lucidum polysaccharide (G, H), Treated cells with Flutamide and Docetaxel (I, J), Treated cells with Docetaxel and Ganoderma lucidum polysaccharide (K, L), and finally Treated cells with Flutamide and Ganoderma lucidum polysaccharide (M, N). Graphs (O) and (R) confirm that Flutamide, Docetaxel, and Ganoderma lucidum polysaccharide used in the specified concentrations alone and combination with each other significantly reduce the metastatic effect and colony formation of both prostate cancer cell lines. Values are given as mean ± SD of three independent tests. Statistical significance was distinct at *P < 0.05, **P < 0.01, and ***P < 0.001 compared to the control group.
Induction of apoptosis by Flutamide, Docetaxel, and Ganoderma lucidum polysaccharide
The apoptotic effects of Flutamide, Docetaxel, and Ganoderma lucidum polysaccharide were investigated by flow cytometry assay. The percentage of early and late apoptotic cells for the PC3 cell line without drug treatment was 0.67 and 4.42%, respectively. These values were 7.72, and 0.66% for the LNCap cell line, respectively. However, they increased to 13.9, 15.5%, 6.19 and 11.5% with Flutamide treatment for PC3 and LNCap cells, respectively. The percentage of apoptotic cells for cells treated with Docetaxel was 4.55 and 22.7%, and 7.97 and 15.1%, while they were 8.48 and 6.80%, and 14.3 and 0.82% with Ganoderma lucidum polysaccharide treatment for PC3 and LNCap cells, respectively. The apoptosis percentage after combined drug treatment increased significantly such that in the combination of Flutamide and Docetaxel, the percentage of apoptotic cells was 27.1 and 36.9, and 14.5 and 26.3% for PC3 and LNCap cells, respectively. Meanwhile, these values were 13.8 and 69.6%, and 27 and 33.8% in the combination of Flutamide and Ganoderma lucidum polysaccharide for PC3 and LNCap cells, respectively. The percentage of apoptotic cells for combined treatment with Docetaxel and Ganoderma lucidum polysaccharide was 4.55 and 22.7%, and 3.71 and 13.6% for PC3 and LNCap cells, respectively. The percentage of necrotic cells was higher in the groups treated with Docetaxel and Flutamide. Finally, the percentage of necrotic cells in the cells treated with Ganoderma lucidum polysaccharide was very low, indicating this drug’s safety (Fig. 4).
Figure 4.
Flow cytometry analysis of prostate cancer cells apoptosis using Annexin-V-Flous (A) and their quantitative analysis (B and C). Q4 demonstrates cells, Q3, early apoptotic cells, Q2, late apoptotic cells, and Q1 displays necrotic cells. Results regarding persuaded apoptosis of prostate cancer cells untreated and treated with Flutamide, Docetaxel, and Ganoderma lucidum polysaccharide and a combination of Flutamide and Docetaxel, Flutamide and Ganoderma lucidum polysaccharide, and finally Docetaxel and Ganoderma lucidum polysaccharide. Values are given as mean ± SD of three independent tests. Statistical significance was distinct at *P < 0.05, **P < 0.01, and ***P < 0.001 compared to the control group.
Docetaxel, Ganoderma lucidum polysaccharide, Flutamide, and a combination of these drugs persuade G1/S arrest in PC3 and LNCaP prostate cancer cells
Figure 5 presents the flow cytometric analysis of the cell cycle for both PC3 and LNCaP prostate cancer cell lines treated with Docetaxel, Ganoderma lucidum polysaccharide, Flutamide, and their combination according to induction of cell cycle arrest. Among the control, PC3 metastatic prostate cancer cells, cells in stages sub-G1, G1, S, and G2/M accounted for 0.85%, 65.41%, 23.78%, and 9.69% of the total cell population, respectively. PC3 metastatic prostate cancer cells treated with Flutamide occasioned an increase in sub-G1 cells (0.85 to 7.93%) and G1 (65.41 to 67.02%), and a decrease in S (23.78 to 22.83%) and G2/M phase (9.69 to 9.18%) cells. Moreover, treatment with Docetaxel caused the elevation of sub-G1 cells (0.85 to 13.05%) and cell decrease in G1 (65.41 to 64.1%), S (23.78 to 18.86%), and G2/M (9.69 to 8.15%) phases. Also, treatment with Ganoderma lucidum polysaccharide increased the number of sub-G1 cells (0.85% to 7.53%) and S phase (23.78 to 31.43%) while it reduced cell count in G1 (65.41 to 57.08%) and G2/M (9.69 to 7.68%) phases. The combination therapy of Flutamide plus Ganoderma lucidum polysaccharide, Docetaxel plus Ganoderma lucidum polysaccharide, Flutamide plus Docetaxel, and three combinations led to a more prominent rise in sub-G1 cells (i.e., 0.85 to 14.36%, 0.85 to 17.77%, 0.85 to 20.79%, and 0.85 to 27.47%, respectively) for PC3 cell line. The results regarding the LNCaP prostate cancer cells were similar, with an improvement in sub-G1 phase cells following the use of Flutamide (0.54 to 7.86%), Docetaxel (0.54 to 9.93%), and Ganoderma lucidum polysaccharide (0.54 to 7.09%). The combination of Flutamide plus Ganoderma lucidum polysaccharide (0.54 to 14.27%), Docetaxel plus Ganoderma lucidum polysaccharide (0.54 to 15.66%), Flutamide plus Docetaxel (0.54 to 19.58%), and three combinations (0.54 to 21.72%) were also investigated. The results of this experiment demonstrated that the cells treated with Ganoderma lucidum polysaccharide, Flutamide, and Docetaxel and their combination significantly arrested the cell cycle phase in G1/S compared to the control and untreated groups. Meanwhile, the sub-G1peak in the flow cytometry graphs indicates apoptosis after treating cancer cells (Fig. 5).
Figure 5.
Analysis of the cell cycle assay of two prostate cancer cell lines LNCaP and PC3 treated with three drugs separately and in combination with each other (A) and their quantitative analysis (B and C). The DNA content of both cell lines after treatment with drugs and their combinations were analyzed using the PI staining kit. An increase in apoptosis was observed in all groups. Values are given as mean ± SD of three independent tests. Statistical significance was distinct at *P < 0.05, **P < 0.01, and ***P < 0.001 compared to the control group.
Effects of Flutamide, Docetaxel & Ganoderma lucidum polysaccharide on the migration of the Prostate cancer cells
Figure 6 presents the results of the migration assay. All three drugs (i.e., Flutamide, Docetaxel, and Ganoderma lucidum polysaccharide), alone and in combination with each other, strongly suppressed the migration of both prostate cancer cells after treatment compared to the control group after 48 h. However, the space created by the scratch between the cells was almost filled in the control group.
Figure. 6.
Migration assay for both prostate cancer cells, LNCap (A) and PC3 (B), and their quantitative analysis (C and D). Control group at 0 h, after treatment with 12 µM and 20 µM Flutamide, 5 µM and 10 µM Docetaxel, 20 µM and 30 µM Ganoderma lucidum polysaccharide, 5 µM Flutamide plus 20 µM Ganoderma lucidum polysaccharide and 10 µM Flutamide plus 30 µM Ganoderma lucidum polysaccharide, 5 µM docetaxel plus 20 µM Ganoderma lucidum polysaccharide and 10 µM Docetaxel plus 30 µM Ganoderma lucidum polysaccharide, 5 µM Flutamide plus 5 µM Docetaxel and 10 µM Flutamide plus 10 µM docetaxel, three combinations and finally Control group after 48 h are shown. Values are given as mean ± SD of three independent tests. Statistical significance was distinct at *P < 0.05, **P < 0.01, and ***P < 0.001 compared to the control group.
Effects of Flutamide, Docetaxel, or Ganoderma lucidum polysaccharide on two prostate cancer cell line nuclei
The results of Hoechst 33,342 fluorescent dye are shown in Fig. 7. After treatment with Flutamide, Docetaxel, or Ganoderma lucidum polysaccharide, significant differences in the nuclear morphology of both cell lines were detected. Many nuclei were fragmented after the LNCap cells were treated with 12 µM Flutamide, 5 µM Docetaxel, 20 µM Ganoderma lucidum polysaccharide, 5 µM Flutamide plus 20 µM Ganoderma lucidum polysaccharide, 5 µM Docetaxel plus 20 µM Ganoderma lucidum polysaccharide, and 5 µM Flutamide plus 5 µM Docetaxel. In addition, PC3 cells were treated with 20 µM Flutamide, 10 µM Docetaxel, 30 µM Ganoderma lucidum polysaccharide, 10 µM Flutamide plus 30 µM Ganoderma lucidum polysaccharide, 10 µM Docetaxel plus 30 µM Ganoderma lucidum polysaccharide, and 10 µM Flutamide plus 10 µM Docetaxel. The corresponding images were captured through fluorescent microscopy (Fig. 7).
Figure 7.
Hoechst staining test (33,342). As seen in Figures, prostate cancer cell line PC3 treated with 20 µM Flutamide, 10 µM Docetaxel, 30 µM Ganoderma lucidum polysaccharide, 10 µM Flutamide plus 30 µM Ganoderma lucidum polysaccharide, 10 µM Docetaxel plus 30 µM Ganoderma lucidum polysaccharide P, 10 µM Flutamide plus 10 µM Docetaxel, three combinations compared with control PC3 cells after 48 h, indicated fragmented nuclear cells which indicates apoptosis and is marked inside the cell.
Effect of Flutamide, Docetaxel, or Ganoderma lucidum polysaccharide on gene expression levels in two prostate cancer cell lines
Both prostate cancer cell lines were treated with Flutamide, Docetaxel, or Ganoderma lucidum polysaccharide and their combination for 48 h. Then, in terms of the three main isoforms of OPN (OPN-a, OPN-b, and OPN-c), the angiogenic gene related to treatment resistance (VEGF-c), the gene expression of the EMT pathway (Snail and E-Cadherin), and prostate cancer biomarker (KLK2) were investigated with Real-Time PCR. Finally, their analysis was done with GraphPad Prism version 9 software (Fig. 8).
Figure 8.
The fold change results of two prostate cancer cell lines (LNCap (A), PC3 (B)) treated with Flutamide, Docetaxel, and Ganoderma lucidum polysaccharide and their combination on the expression of target genes for 48 h. Genes involved in growth, progression, angiogenesis, metastasis of cancer contained OPN isoforms, VEGF and Epithelial–mesenchymal transition (EMT) pathway were investigated. On the other hand, the expression of the KLK2 gene, which increases the proliferation of castration-resistant prostate cancer cells, was also investigated. As can be seen, except flutamide drug, Docetaxel, and Ganoderma lucidum polysaccharide and their combination were effective on the EMT process, while all three drugs were effective on the specific gene of prostate cancer KLK2. Values are given as mean ± SD of three independent experiments. Statistical significance was defined at p < 0.05*0.01, p < 0.001*p < 0.01 compared to the respective control.
As shown in Fig. 8, in the LNCap cell line, all the treatment groups, individually and in combination, caused a significant decrease in the expression of the isoform OPN-a gene (P < 0.05). About the isoform OPN-b gene, all groups significantly lowered the expression (P < 0.01), and only the group treated with Flutamide increased the OPN expression gene (P < 0.05). Ganoderma lucidum polysaccharide, the combination of Flutamide and Ganoderma lucidum polysaccharide, and Docetaxel plus Ganoderma lucidum polysaccharide significantly decreased the expression of the isoform OPN-c gene (P < 0.01). In contrast, Flutamide non-significantly increased this gene expression. Docetaxel, Ganoderma lucidum polysaccharide, and the combination of Docetaxel and Ganoderma lucidum polysaccharide caused a significant decrease in the expression of the VEGF-c gene (P < 0.05). However, Flutamide caused a significant increase in the VEGF-c gene expression (P < 0.05). In the case of EMT pathway genes, Flutamide significantly increased the Snail gene expression and decreased the E-Cadherin gene expression (P < 0.01). In contrast, the other two drugs and their combination showed the opposite effect of Flutamide (P < 0.001). All three drugs (Flutamide, Docetaxel, and Ganoderma lucidum polysaccharide) and their combination significantly decreased the expression of the prostate cancer biomarker entitled KLK2 (P < 0.01).
In the PC3 cell line, Flutamide significantly increased the gene expression of OPN-c (P < 0.001) and OPN-b (P < 0.01) isoforms. At the same time, Docetaxel and Ganoderma lucidum polysaccharide alone caused a significant decrease in OPN-c gene expression (P < 0.01). All three drugs, individually and in combination, reduced the expression of the VEGF-c gene (P < 0.01). Except for Flutamide, the other drugs and drug combinations significantly decreased the Snail gene expression and increased the E-cadherin gene expression (P < 0.01 and P < 0.001). In contrast, Flutamide did the opposite in a significant way. Similarly, except Docetaxel (non-significantly), the rest of the drugs and their combinations caused a significant decrease in prostate cancer biomarker expression (P < 0.01).
Discussion
New therapeutic strategies have been discovered to treat prostate cancer, although none of them has provided a definitive cure. Flutamide and the chemotherapy drug Docetaxel are still the standard first-line treatment for advanced prostate tumors; however, drug resistance, high price, unavailability, and severe side effects limit their clinical application. Accordingly, increasing cell sensitivity to Flutamide and Docetaxel and reducing their side effects is essential to help prevent prostate cancer progression.
This study attempted to determine whether the combined treatment of routinely used drugs with natural products derived from plants, including Ganoderma lucidum polysaccharide extract, can overcome the limitations of drugs such as Flutamide and Docetaxel in patients. The antitumor activity of Ganoderma lucidum polysaccharide, including cell growth reduction, apoptosis and cell death induction, invasion reduction, and cell migration, has been proven in different studies by signaling different pathways. For the first time, our results indicated that Ganoderma lucidum polysaccharide plant extract increases apoptosis in both prostate cancer cell lines and modulates the EMT pathway and KLK2 biomarker in favor of better response to treatment.
In another study, de Camargo MR et al. reported that Ganoderma lucidum polysaccharide decreased EMT markers, changed cancer stem cell characteristics, and increased drug sensitivity in oral squamous cells. These results are in line with the results obtained from our study13. According to Cao et al., 21.40% of the published articles related to the performance of Ganoderma lucidum polysaccharide had shown this extract's effectiveness in treating cancer. Therefore, it is considered the most popular herbal medicine. The most crucial pathway on which the effectiveness of Ganoderma lucidum polysaccharide has been determined is through the modulation of NF-Kb and MAPK8,14,15. Besides, another study has shown that Ganoderma lucidum polysaccharide with 5α-reductase inhibitory activity and the ability to bind to the androgen receptor (AR) can inhibit androgen-induced LNCaP cell growth11. Downregulation of AR signaling by Ganoderma lucidum polysaccharide provides an essential mechanism for its anti-androgenic activity. In this regard, the present study also proved that Ganoderma lucidum polysaccharide significantly decreased the KLK2 expression gene, one of the AR pathway genes.
Li et al. showed that the use of Docetaxel every three weeks (75 mg/m (2)) together with oral casodex (50 mg) once daily reduced the level of prostate-specific antigen (PSA) by 50% and improved the quality of life of CRPC patients16. Wang et al.2 found that Ganoderma lucidum polysaccharide had antitumor and apoptosis-inducing activity against PC-3 prostate cancer cells by inhibiting Jak1/STAT3 activity2. Jiahua et al. showed that Ganoderma lucidum polysaccharide prevented the growth of malignant breast cancer cells by modulating the Akt/NF-kB pathway17. Furthermore, Cen et al. reported that combining Ganoderma lucidum polysaccharide with cisplatin reduced tumor growth and improved intestinal damage caused by cisplatin via inhibiting ROS-mediated ERK signaling against ovarian cancer. Besides, Ganoderma lucidum polysaccharide significantly sensitized cells to cisplatin in ovarian cancer18. Zhao et al. showed that Ganoderma lucidum polysaccharide and cisplatin caused cell cycle arrest in the G2/M phase and caused apoptosis by activating caspase 3 and p53 up-regulation. Finally, they suggested that Ganoderma can rise the sensitivity of epithelial ovarian cancer cells to cisplatin19.
In another study, Zhong et al. found that Ganoderma lucidum polysaccharide increased pyroptotic cell death in breast cancer cells by activating caspase 3 and enhanced antitumor immune responses through NK/CD8 + T cells in the tumor20.
We presented that Ganoderma lucidum polysaccharide alone and combined with Flutamide and/or Docetaxel effectively stopped the cell cycle and augmented apoptosis. In this regard, Wu et al. and Liu et al. presented that Ganoderma lucidum polysaccharide extract had anticancer activities, including direct inhibition of living cells, cell survival, cell proliferation inhibition via cancer-specific cell cycle arrest and apoptosis in various cancer cells21,22.
Furthermore, the present study showed that Ganoderma lucidum polysaccharide sensitized prostate cancer cell lines to lower doses of Docetaxel and Flutamide. Besides, flow cytometry results showed that it reduces necrosis; hence, toxicity caused by the standard drug and had additive and synergistic effects when used along with Flutamide and Docetaxel. The results of the present study allow researchers to use Ganoderma lucidum polysaccharide alone and in combination with the standard drugs to increase the treatment effectiveness with less toxicity.
In line with the results obtained in this research, Suárez-Arroyo et al.23 exhibited that Ganoderma lucidum polysaccharide can sensitize cancer cells to radiation and other drugs used in breast cancer treatment. They used the combination of Ganoderma lucidum polysaccharide and Carboplatin in-vivo and in-vitro. Furthermore, they observed that this combination decreased cell viability, increased cell death, and delayed the response to DNA damage. These authors observed a significant effect in inhibiting tumor growth, size, and volume in mice without systemic toxicity23.
Opattova A. et al.24 exhibited that natural compounds, especially Ganoderma lucidum polysaccharide extract, sensitized colorectal cancer cells to the chemotherapy drug 5-Fluorouracil (5FU) by accumulating DNA damage. They also presented that co-treatment of Ganoderma lucidum polysaccharide with 5FU reduced tumor volume and increased survival of mice compared to the group treated with 5FU alone24.
Many reports, including Tilli et al.25 and our previous research, have shown that tumor resistance and cancer progression increased the expression of OPN-b and OPN-c isoforms26–28. OPN expression is strongly correlated with HIF-1 α and VEGF expression. The present study revealed that Ganoderma lucidum polysaccharide decreased the expression of all three isoforms of the OPN and VEGF genes. In agreement with these results, Meng et al. reported that Ganoderic acid in Ganoderma lucidum polysaccharide reduced the OPN expression, lowered proliferation and migration, and increased apoptosis in smooth muscle cells29. Moreover, Sohretoglu et al. stated that Ganoderma lucidum polysaccharide suppressed angiogenesis in prostate cancer by reducing the expression of VEGF and TGF-β1 by lowering AP-1 activity through AKT/ERK6.
Topics that can be addressed in future studies include the effects of Ganoderma lucidum polysaccharide on xenograft mouse models to evaluate the resistance of prostate cancer cells to treatment and using the Western blot technique to analyze the expression of OPN, VEGF isoforms, KLK2, and the EMT pathway at the protein level.
Conclusion
Overall, Ganoderma lucidum polysaccharide can enhance apoptosis induction, inhibit cell growth, migration, colonization, and angiogenesis, and sensitize prostate cancer cells to Flutamide and Docetaxel chemotherapy. Regarding its anti-androgenic activity, this compound can be used as a potential approach to treat prostate cancer. Accordingly, combining Ganoderma lucidum polysaccharide with Flutamide or Docetaxel could potentially provide a new therapeutic strategy against prostate cancer.
Acknowledgements
The authors would like to thank the Urology Research Center at Sina Hospital, Tehran University of Medical Sciences, Tehran, Iran.
Abbreviations
- 5FU
5-Fluorouracil
- AKT
AK mouse plus Transforming or Thymoma
- AP-1
Activator protein 1
- AR
Androgen receptor
- DNA
Deoxyribonucleic acid
- EMT
Epithelial-Mesenchymal Transition pathway
- ERK
Extracellular signal-regulated kinases
- GLP
Ganoderma Lucidum Polysaccharide
- HIF-1 α
Hypoxia-inducible factor-1α
- Jak1
Janus kinase 1
- KLK2
Kallikrein Related Peptidase 2
- MAPK
Mitogen-activated protein kinase
- MTT
Microculture tetrazolium test
- NF-kB
Nuclear factor-κB
- NK
Natural killer cell
- OPN
Osteopontin
- PCa
Prostate cancer
- PSA
Prostate-specific antigen
- ROS
Reactive oxygen species
- STAT3
Signal transducer and activator of transcription 3
- TGF-β1
Transforming Growth Factor Beta 1
- VEGF
Vascular endothelial growth factor
Author contributions
M.R.A. edited the manuscript, R.R., A.FY and D.T. principal investigation and validation, A.M. writing-original draft, preparation of figures, tables, data analysis, and methodology, writing-review and editing, resources, H.A.G.H., and L.Z.B. and P.D.F. resources, S.M.K.A. study design and conceptualization. All authors approved the final version of the manuscript.
Data availability
Data will be provided on request. Seyed Mohammad Kazem Aghamir as Corresponding author is responsible for data from the study.
Competing interests
The authors declare no competing interests.
Footnotes
This article has been retracted. Please see the retraction notice for more detail: 10.1038/s41598-025-34603-1
Publisher's note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Change history
1/6/2026
This article has been retracted. Please see the Retraction Notice for more detail: 10.1038/s41598-025-34603-1
References
- 1.Siegel, R. L., Miller, K. D., Wagle, N. S., Jemal, A. Cancer statistics, 2023. CA: A cancer J. Clin. 73(1): 17-48 (2023). [DOI] [PubMed]
- 2.Wang, X. et al. Ganoderma lucidum put forth anti-tumor activity against PC-3 prostate cancer cells via inhibition of Jak-1/STAT-3 activity. Saudi J. Biol. Sci.27(10), 2632–2637 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Heah, K. G., Suhaimi, S. N. B., Shobri, N. R. B. M., Zhu, H.-J. & Froemming, G. In vitro and in vivo studies of ganoderma lucidum in cancer. J. Int. Dental Med. Res.13(1), 379–383 (2020). [Google Scholar]
- 4.Dai, S., Liu, J., Sun, X. & Wang, N. Ganoderma lucidum inhibits proliferation of human ovarian cancer cells by suppressing VEGF expression and up-regulating the expression of connexin 43. BMC Complement. Altern. Med.14(1), 1–8 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Jang, K.-J., Son, I.-S., Shin, D. Y., Yoon, H.-M. & Choi, Y. H. Anti-invasive activity of ethanol extracts of Ganoderma lucidum through tightening of tight junctions and inhibition of matrix metalloproteinase activities in human gastric carcinoma cells. J. Acupuncture Meridian Stud.4(4), 225–235 (2011). [DOI] [PubMed] [Google Scholar]
- 6.Sohretoglu, D. & Huang, S. Ganoderma lucidum polysaccharides as an anti-cancer agent. Anticancer Agents Med. Chem.18(5), 667–674 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Jin, X., Ruiz Beguerie, J., Sze, D. M. & Chan, G. C. Ganoderma lucidum (Reishi mushroom) for cancer treatment. Cochrane Database Syst. Rev.4(4), Cd0007731 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Cao, Y., Xu, X., Liu, S., Huang, L. & Gu, J. Ganoderma: A cancer immunotherapy review. Front. Pharmacol.9, 1217 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Keypour, S., Riahi, H. & Rafati, H. A review on the biological active compounds and medicinal properties of Ganoderma lucidum. J. Med. Plants.12(46), 13–24 (2013). [Google Scholar]
- 10.Boh, B., Berovic, M., Zhang, J. & Zhi-Bin, L. Ganoderma lucidum and its pharmaceutically active compounds. Biotechnol. Annu. Rev.13, 265–301 (2007). [DOI] [PubMed] [Google Scholar]
- 11.Saadati, M., Tamehri, S., Pour Kamali, M. & Taheri, D. Phosphatase and tensin gene associated with features of aggressive prostate cancer. Transl. Res. Urol.3(1), 32–37 (2021). [Google Scholar]
- 12.Arur, S. et al. Annexin I is an endogenous ligand that mediates apoptotic cell engulfment. Dev. Cell4(4), 587–598 (2003). [DOI] [PubMed] [Google Scholar]
- 13.de Camargo, M. R. et al. Ganoderma lucidum polysaccharides inhibit in vitro tumorigenesis, cancer stem cell properties and epithelial-mesenchymal transition in oral squamous cell carcinoma. J. Ethnopharmacol.286, 114891 (2022). [DOI] [PubMed] [Google Scholar]
- 14.Azodian Ghajar, H. & Koohi, O. R. The promising role of MicroRNAs, long non-coding RNAs and circular RNAs in urological malignancies. Transl. Res. Urol.4(1), 9–23 (2022). [Google Scholar]
- 15.Khatami, F., Aghamir, S. M. K., Salmaninejad, A., Shivarani, S. & Khorrami, M. H. Biomarkers for prostate cancer diagnosis from genetic perspectives. Transl. Res. Urol.2(2), 51–58 (2020). [Google Scholar]
- 16.Li, Y. F. et al. Intermittent tri-weekly docetaxel plus bicalutamide in patients with castration-resistant prostate cancer: A single-arm prospective study using a historical control for comparison. Asian J. Androl.15(6), 773–779 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Jiang, J., Slivova, V., Harvey, K., Valachovicova, T. & Sliva, D. Ganoderma lucidum suppresses growth of breast cancer cells through the inhibition of Akt/NF-kappaB signaling. Nutr. Cancer.49(2), 209–216 (2004). [DOI] [PubMed] [Google Scholar]
- 18.Cen, K. et al. Sporoderm-broken spores of ganoderma lucidum sensitizes ovarian cancer to cisplatin by ROS/ERK signaling and attenuates chemotherapy-related toxicity. Front. Pharmacol.13, 826716 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Zhao, S. et al. Ganoderma lucidum exerts anti-tumor effects on ovarian cancer cells and enhances their sensitivity to cisplatin. Int. J. Oncol.38(5), 1319–1327 (2011). [DOI] [PubMed] [Google Scholar]
- 20.Zhong, C. et al. Ganoderma lucidum extract promotes tumor cell pyroptosis and inhibits metastasis in breast cancer. Food Chem. Toxicol.174, 113654 (2023). [DOI] [PubMed] [Google Scholar]
- 21.Wu, G.-S. et al. Ganoderic acid DM, a natural triterpenoid, induces DNA damage, G1 cell cycle arrest and apoptosis in human breast cancer cells. Fitoterapia.83(2), 408–414 (2012). [DOI] [PubMed] [Google Scholar]
- 22.Liu, R.-M., Li, Y.-B. & Zhong, J.-J. Cytotoxic and pro-apoptotic effects of novel ganoderic acid derivatives on human cervical cancer cells in vitro. Eur. J. Pharmacol.681(1–3), 23–33 (2012). [DOI] [PubMed] [Google Scholar]
- 23.Suárez-Arroyo, I. J. et al. Ganoderma lucidum enhances carboplatin chemotherapy effect by inhibiting the DNA damage response pathway and stemness. Am. J. Cancer Res.12(3), 1282–1294 (2022). [PMC free article] [PubMed] [Google Scholar]
- 24.Opattova, A. et al. Ganoderma Lucidum induces oxidative DNA damage and enhances the effect of 5-Fluorouracil in colorectal cancer in vitro and in vivo. Mutat. Res. Genet. Toxicol. Environ. Mutagen.845, 403065 (2019). [DOI] [PubMed] [Google Scholar]
- 25.Tilli, T. M. et al. Both osteopontin-c and osteopontin-b splicing isoforms exert pro-tumorigenic roles in prostate cancer cells. Prostate72(15), 1688–1699 (2012). [DOI] [PubMed] [Google Scholar]
- 26.Mirzaei, A., Rashedi, S., Akbari, M. R., Khatami, F. & Aghamir, S. M. K. Combined anticancer effects of simvastatin and arsenic trioxide on prostate cancer cell lines via downregulation of the VEGF and OPN isoforms genes. J. Cell. Mol. Med.26(9), 2728–2740 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- 27.Mirzaei, A. et al. Osteopontin b and c splice isoforms in leukemias and solid tumors: Angiogenesis alongside chemoresistance. Asian Pac. J. Cancer Prev.: APJCP.19(3), 615 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Mirzaei, A., Deyhimfar, R., Azodian Ghajar, H., Mashhadi, R., Noori, M., Dialameh, H., et al. Quercetin can be a more reliable treatment for metastatic prostate cancer than the localized disease: An in vitro study. J. Cell. Mol. Med. (2023). [DOI] [PMC free article] [PubMed]
- 29.Meng, Y. et al. Ganoderic acid A suppresses the phenotypic modulation of pulmonary artery smooth muscle cells through the inactivation of PI3K/Akt pathway in pulmonary arterial hypertension. Food Sci. Technol.42, e83221 (2021). [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Data will be provided on request. Seyed Mohammad Kazem Aghamir as Corresponding author is responsible for data from the study.












