Abstract
The short in vivo half-life of streptokinase limits its efficacy as an efficient blood clot-dissolving agent. During the clot-dissolving process, streptokinase is processed to smaller intermediates by plasmin. Two of the major processing sites are Lys59 and Lys386. We engineered two versions of streptokinase with either one of the lysine residues changed to glutamine and a third version with both mutations. These mutant streptokinase proteins (muteins) were produced by secretion with the protease-deficient Bacillus subtilis WB600 as the host. The purified muteins retained comparable kinetics parameters in plasminogen activation and showed different degrees of resistance to plasmin depending on the nature of the mutation. Muteins with double mutations had half-lives that were extended 21-fold when assayed in a 1:1 molar ratio with plasminogen in vitro and showed better plasminogen activation activity with time in the radial caseinolysis assay. This study indicates that plasmin-mediated processing leads to the inactivation of streptokinase and is not required to convert streptokinase to its active form. Plasmin-resistant forms of streptokinase can be engineered without affecting their activity, and blockage of the N-terminal cleavage site is essential to generate engineered streptokinase with a longer in vitro functional half-life.
The formation of pathologic blood clots that block the circulation to heart muscle can result in acute myocardial infarction (heart attack). Several blood clot-dissolving agents including streptokinase and tissue-specific plasminogen activator are commonly applied to treat these patients. Many large-scale clinical trials (10, 14, 17) have demonstrated both the short- and long-term benefits of these agents in saving lives. To gain maximum benefits of thrombolytic therapy in restoring blood flow, limiting damage to heart muscles, and preserving heart functions, early treatment is particularly important (14). The relationship between early treatment with thrombolysis and lower mortality has been well established (6, 11, 11a, 16, 27, 30, 33, 34, 44). However, one of the limitations of these blood clot-dissolving agents is their short in vivo half-lives. With half-lives of 30 min for streptokinase (15) and 5 min for tPA (19), these agents are commonly introduced into the patients by a 30- to 90-min infusion. If the half-lives of these agents can be prolonged, the agents could possibly be administered as a single bolus intravenous injection and patients could be treated upon the arrival of the medical personnel. This would help minimize the time delay in the transportation of patients to hospital. The reocclusion rate could also be reduced by using these long-half-life clot-dissolving agents.
Streptokinase is a 47-kDa (414-amino-acid) protein from pathogenic strains of the Streptococcus family (25). To dissolve a blood clot, streptokinase forms a 1:1 molar complex with plasminogen (1). The resulting complex (8) has the ability to convert plasminogen to plasmin, the active protease that degrades fibrin in the blood clot. However, plasmin also rapidly processes streptokinase to smaller fragments. This can be a major factor contributing to the short half-life of streptokinase. The processing pathway of streptokinase has been well characterized (28, 38, 39). Several intermediates, including a few products with molecular masses of 37 to 44 kDa, are transiently accumulated (38, 39). The 42- to 44-kDa intermediates appear first and are generated by C-terminal processing, since they have identical N-terminal residues to those observed in the intact streptokinase (28). Isolation of a short C-terminal peptide with the N-terminal sequence corresponding to Tyr402 (38) indicates that one of the C-terminal cleavage events takes place between Arg401 and Tyr402. The 37-kDa product appears later and is relatively stable (4, 28, 38, 39). N-terminal sequencing and composition analysis suggest that this fragment has the sequence corresponding to Ser60 to Lys386 from the authentic streptokinase (38). This product is therefore generated through both N- and C-terminal processing events. Although this 37-kDa product has high affinity to both plasminogen and plasmin, it retains only 16% of the activity of the intact streptokinase in plasminogen activation (38). Further processing of the 37-kDa product at a series of cleavage sites (38) results in the complete degradation of streptokinase into small fragments. Since plasmin is a trypsin-like serine protease that specifically cleaves the peptide bond after lysine or arginine (45), it would be interesting to see whether selectively changing lysine and arginine residues at these processing sites to other amino acids (e.g., glutamine) would generate plasmin-resistant streptokinase that may have a longer functional half-life. The successful generation of these new versions of streptokinase depends critically on whether processing at these sites is a necessary event. Currently, it is uncertain whether these processing events are simply a consequence of positioning lysine and arginine residues at the flexible and surface-exposed regions or are essential events in the conversion of streptokinase to the active form. It has been observed that the 7-kDa N-terminal peptide can associate with the 37-kDa intermediate to form a functional plasminogen activator that has almost the full activity of the intact streptokinase (38). In a similar situation, N-terminal processing that results in the removal of the first 10 amino acids from staphylokinase, another plasminogen activator from lysogenic strains of Staphylococcus, by plasmin is demonstrated to be essential in the generation of the active staphylokinase (37). To determine the significance of the N-terminal processing event and to explore the possibility of developing engineered forms of streptokinase with longer functional half-lives, we report the development of various forms of streptokinase through site-directed mutagenesis. These mutant proteins (abbreviated as muteins) of streptokinase were produced by the Bacillus subtilis secretory production system (48). Biochemical characterization and in vitro processing studies of these purified streptokinase muteins illustrate that plasmin-resistant streptokinase can be developed. Some of these engineered muteins have longer in vitro functional half-lives and show better activity with time.
MATERIALS AND METHODS
Bacterial strains and culture conditions.
A six-extracellular-protease-deficient B. subtilis strain, WB600 (trpC2 nprA apr epr bfp mpr::ble nprB::ery) (49), was used for routine transformation and expression studies. Transformed cells were plated on tryptose blood agar base (TBAB; Difco, Detroit, Mich.) plates containing 10 μg of kanamycin per ml. Cells carrying expression vectors were cultivated in superrich medium (12) with kanamycin. All the expression vectors are pUB18 derivatives (43). Therefore, WB600(pUB18) serves as a negative control for the study of streptokinase production. The initial cell density in the culture was adjusted to 10 Klett units (1 Klett unit is equivalent to approximately 106 cells/ml). When the cell density reached 100 Klett units, sucrose was added at a final concentration of 2% (wt/vol) to induce the expression. The culture supernatant was collected by centrifugation 5 h after induction.
Site-directed mutagenesis of the streptokinase production plasmid.
Plasmid pSK3 (48) is an expression vector in B. subtilis that is used to produce streptokinase with the sucrose-inducible regulatory region from B. subtilis sacB, encoding levansucrase, to control the expression. In this expression vector, secretion of streptokinase is directed by the sacB signal sequence (41, 47). To change Lys59 to either glutamine or glutamic acid, site-directed mutagenesis based on the inverse PCR method described by Hemsley et al. (13) was used. Two primers, SKMF [5′ CAAGGCTTAAGTCCA(C/G)AATCAAAACC 3′] and SKMB (5′ CTCTGTCTTTCCTCCATGAGCAGG) were used for PCR by using the supercoiled pSK3 plasmid as the template. The amplified fragment was then end repaired, kinase treated, and recircularized by ligation. Plasmid DNA was transformed to WB600. This site-directed mutagenesis method allows direct introduction of mutations to B. subtilis vectors without using E. coli vectors as the intermediate. The restriction enzymes and DNA-modifying enzymes used in this study are from New England Biolabs Canada, Ltd. (Mississauga, Ontario, Canada), Pharmacia Biotech Inc. (Baie d’Urfé, Quebec, Canada), and GIBCO BRL Canada (Burlington, Ontario, Canada).
Purification of streptokinase and its derivatives.
Streptokinase (or its derivatives) from the culture supernatant was precipitated and concentrated by adding ammonium sulfate to 60% saturation. After dialysis, the sample was applied to preparative nondenaturing polyacrylamide gels (7.5%, wt/vol) that have the same composition as that for the standard sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) except for the omission of SDS. To minimize the presence of free radicals that may modify functional groups of proteins, the gels were prerun for 2 h with the addition of reduced glutathione, at a final concentration of 50 μM, to the electrophoresis buffer in the upper reservoir. The preelectrophoresis buffer was decanted, and fresh buffer containing 0.1 mM sodium thioglycolate was used for the actual run. At the end of the electrophoretic run, a strip of gel was excised and briefly stained with 1% (wt/vol) Coomassie blue R-250 for 5 min. The location of the major protein band was determined and used as the reference point to locate streptokinase in the nonstained gel. The excised gel was cut into small pieces, and the protein was electroeluted under a constant current (5 mA per tube) with Tris-glycine buffer (25 mM Tris base, 192 mM glycine [pH 8.3]) for 8 h at 4°C with the electroelution system from Bio-Rad Laboratories Canada Ltd. (Mississauga, Ontario, Canada). The eluted protein sample was collected and dialyzed against the streptokinase assay buffer (50 mM Tris-HCl [pH 7.2], 0.1 M NaCl, 0.001% [wt/vol] Tween 80).
Preparation of the 37-kDa processing intermediate from streptokinase.
To determine the N-terminal sequence of the 37-kDa processing intermediate from streptokinase, streptokinase was mixed with plasminogen in a 1:1 molar ratio in the assay buffer for 10 min. The reaction was terminated by adding the sample-loading buffer for SDS-PAGE, and the sample was loaded onto a 12% polyacrylamide gel containing SDS. The resolved protein bands were then electroblotted to Immobilon membrane as previously described (26). These protein bands were briefly stained, and the protein band corresponding to the 37-kDa protein was excised. The first five amino acid residues from this protein was determined at the Microchemistry Center, University of Victoria.
Determination of the activity of streptokinase and its kinetic parameters for plasminogen activation.
The activity of streptokinase was determined by two methods (48): the colorimetric method (7) with tosyl-glycyl-prolyl-lysine-4-nitroanilide acetate (Chromozym PL; Boehringer Mannheim Canada, Laval, Quebec, Canada) as the substrate and the radial caseinolysis method (36) with agarose containing both plasminogen and skim milk. To determine the kinetic parameters for the activation of plasminogen by streptokinase and its muteins, the conditions described by Shi et al. (38) were used except that Chromozym PL was used as the substrate. In these assays, streptokinase or its muteins were mixed with plasminogen at various concentrations (0.02 to 0.4 μM) and the change in absorbance at 405 nm was monitored at 37°C by using a Beckman DU65 spectrophotometer equipped with a constant-temperature cuvette chamber. The final concentration of streptokinase or its muteins was 0.003 μM. The kinetic data were analyzed with the mathematic model presented by Wohl et al. (46) and graphed as a Lineweaver-Burk plot. This one-stage assay allows the determination of the apparent Michaelis constant (Km) of streptokinase and its derivatives to plasminogen and the catalytic rate constant (kp) of plasminogen activation.
Half-life determination.
To determine the half-lives of various forms of streptokinase in the plasminogen activation process, streptokinase was mixed with plasminogen in a 1:1 molar ratio and samples were collected at different time points up to 60 min and added to microcentrifuge tubes containing sample application buffer for SDS-PAGE in a boiling-water bath. SDS-PAGE and Western blotting with antibodies against streptokinase from rabbit were performed as described previously (48). To ensure that all the proteins were completely transferred to the nitrocellulose filter, the electroblotted gels were restained with Coomassie blue. Blots with complete protein transfer were used for quantitative analysis. Pictures of Western blot were taken with the GDS 7500 gel documentation system from UVP, Inc. (San Gabriel, Calif.). The intensity of the 47-kDa protein which represents the intact form of streptokinase (see Fig. 2) on the Western blot was quantified with a Fuji bioimaging analyzer (BAS 1000, Fuji Medical Systems U.S.A., Stamford, Conn.) and the MacBAS software.
FIG. 2.
Processing of streptokinase and its muteins by plasmin. Streptokinase and plasminogen were mixed in a 1:1 molar ratio and incubated at 37°C. Samples were collected at different time points (in minutes) and analyzed by Western blot with streptokinase-specific polyclonal antibodies. (a) Wild-type streptokinase; (b) SKN460; (c) SKN460-C32. An asterisk marks a new form of intermediate generated during the processing of SKN460.
Other methods.
Protein concentrations were determined by the Bradford method (2) with reagents from Bio-Rad Laboratories Canada Ltd. Glu-plasminogen was prepared from human plasma by using essentially the lysine-Sepharose method (9, 42). To identify colonies that show streptokinase activity, cells were plated on TBAB agar plates overlaid with a thin layer of agarose (0.5% [wt/vol] agarose in physiological buffered saline with 0.5 mg of plasminogen and 0.1 g of skim milk in a final volume of 10 ml). Other general chemicals and reagents are from Sigma-Aldrich Canada Ltd. (Oakville, Ontario, Canada).
RESULTS
Streptokinase muteins with mutations in the N-terminal region.
To determine whether the plasmin-mediated processing of streptokinase at the N-terminal region is an essential step in the generation of active streptokinase, the nucleotide sequence AAA, which corresponds to Lys59 in the natural streptokinase, was changed to CAA or GAA by site-directed mutagenesis involving inverse PCR. From 200 transformants, 28 were randomly selected and spotted on to TBAB agar plates that had been overlaid with a thin layer of agarose containing both plasminogen and skim milk. Based on the halo size, these transformants were divided into three groups. The first group (14 colonies) had the largest halos. The second group (13 colonies) had halos smaller than those in group 1 but still slightly larger than that for the positive control strain, WB600(pSK3), which produces the wild-type streptokinase. The third group (1 colony) did not show any halo surrounding the colony. The nucleotide sequence of a 253-bp ClaI-BstEII region which covers the predicted mutation was determined from five group 1 mutants. They all carried the A-to-C mutation, which converts Lys59 to glutamine. No other mutations could be observed within the sequenced 253-bp region. Five randomly selected group 2 mutants also carried the A-to-G mutation, which converts Lys59 to glutamic acid. The only mutant from group 3 was found to carry the same mutation as that observed in the group 1 mutants except for the presence of an unexpected 1-nucleotide deletion at the 5′ end region of the mutagenic primer. This introduced a frameshift mutation and provided an explanation for the failure to observe the streptokinase activity from this clone. Since Taq polymerase does not have the proofreading function (35), it could possibly introduce extra mutations to DNA fragments during amplification. To eliminate the possibility of the presence of extra mutations in both the group 1 and group 2 mutants, the 253-bp ClaI-BstEII fragment was isolated from mutants in both groups and each of these fragments was ligated to the 6-kb ClaI-BstEII-digested pSK3, which has never been subjected to inverse PCR-based mutagenesis. ClaI and BstEII sites were selected for this fragment exchange reaction because each of these sites is unique on pSK3 and they flank the predicted mutation. To confirm the successful introduction of the group 1 and group 2 mutations to pSK3, the 253-bp ClaI-BstEII region in the resulting transformants was sequenced. Plasmids pSKN460 and pSKN461 were shown to carry group 1 and group 2 mutations, respectively. Consistent with the previous observation, the halos of WB600(pSKN460) and WB600(pSKN461) are larger than that of WB600(pSK3) (data not shown). Since these muteins were produced at a comparable level relative to the wild-type streptokinase (data not shown), this observation indicated that these muteins retain relatively good activity in plasminogen activation. SKN460 was selected for further characterization because of its high activity. The secretory production of SKN-460 is shown (Fig. 1a, lane 5).
FIG. 1.
Production and purification of streptokinase and its muteins. (a) Western blot of secreted streptokinase. Lanes: 1, prestained markers, with the molecular mass in kilodaltons shown on the left; 2 to 6, 60 μl of culture supernatant from WB600(pUB), WB600(pSK3), WB600(pSKC32), WB600(pSKN460), and WB600(pSKN460-C32), respectively. (b) SDS-PAGE analysis of purified streptokinase. Lanes: 1, molecular mass markers; 2 to 5, 5 μl of purified SKN460, SKC32, SKN460-C32 and natural streptokinase, respectively.
Streptokinase muteins with mutations in the C-terminal region.
To block the plasmid-mediated processing of streptokinase at the C-terminal region, Lys386 in streptokinase should be changed to glutamine. As reported previously (48), residual proteases from WB600 could also degrade wild-type streptokinase at the C-terminal region and generated a low percentage of degraded streptokinase (Fig. 1a, lane 3). To eliminate the C-terminal degradation, hydrophobic residues at positions 380 to 384 were changed to either polar or charged residues and Lys386 was changed to glutamine. The resulting streptokinase muteins can be produced in WB600 in intact form and retain almost the full activity of the authentic streptokinase (48). One of the WB600 strains carrying the mutated streptokinase gene in the expression vector (pSKC32) was used here to study the C-terminal processing event mediated by plasmin. Figure 1a (lane 4) shows the production of this mutein in intact form from WB600.
Streptokinase muteins with mutations in both the N- and C-terminal regions.
To generate a streptokinase mutein that shows resistance to the plasmin-mediated processing, the 1.3-kb BstEII-PstI fragment encoding the C-terminal portion of streptokinase in pSKN460 was replaced by the one from pSKC32 to generate pSKN460-C32. The successful exchange of this fragment was confirmed by nucleotide sequencing. WB600(pSKN460-C32) produced this mutein in intact form (Fig. 1a; lane 6). This mutein retains biological activity in plasminogen activation (see Table 1 and Fig. 3a).
TABLE 1.
Steady-state kinetic parameters of streptokinase and its muteins for plasminogen activation
| Streptokinase | Km (μM) | kp (min−1) |
|---|---|---|
| Wild type | 0.20 ± 0.02 | 34.36 ± 1.2 |
| SKN-460 | 0.22 ± 0.03 | 32.16 ± 1.3 |
| SKC-32 | 0.21 ± 0.03 | 34.02 ± 1.2 |
| SKN460-C32 | 0.28 ± 0.04 | 35.17 ± 1.4 |
FIG. 3.
Activity of various forms streptokinase based on the radial caseinolysis. Each form of streptokinase, in equal quantities, was loaded into individual wells and incubated at 37°C for 12 h. Numbers indicate the relative activity of each form of streptokinase.
Plasmin-mediated processing of streptokinase and its derivatives.
Natural streptokinase (SK3) and three other streptokinase muteins (SKN460, SKC32, and SKN460-C32) produced from WB600 strains were purified from the culture supernatant by electrophoresis on a native polyacrylamide gel. Purified streptokinase proteins were found to be homogeneous (Fig. 1b) and were used to study the plasmin-mediated processing by mixing streptokinase with plasminogen in a 1:1 molar ratio. The processing reaction was conducted at 37°C. To avoid the complication for the presence of plasminogen and its derivatives in the reaction mixture, streptokinase and its processed intermediates were identified by Western blotting with streptokinase-specific polyclonal antibodies. As shown in Fig. 2a, natural streptokinase was rapidly converted to various processed forms with molecular masses around 44 kDa. The 37-kDa intermediate could also be observed after 1 min of reaction and became the major product after 10 min of reaction. N-terminal sequencing of the first five amino acid residues from the electroblotted 37-kDa protein showed the sequence Ser-Lys-Pro-Phe-Ala. This sequence matched that at positions 60 to 64 in the natural streptokinase and confirmed that an N-terminal processing event took place between Lys59 and Ser60. For the streptokinase mutein SKN460, the change of Lys59 to glutamine indeed blocked the major N-terminal processing event mediated by plasmin. Accumulation of the 44- to 46-kDa processing intermediates was observed (Fig. 2b). The 44-kDa product was relatively stable and could be observed even after 60 min of reaction. This is not the case for the wild-type streptokinase. At least one new intermediate was detected. On a relative scale, it migrated faster than the stable 37-kDa intermediate generated in the reaction with the natural streptokinase. For the streptokinase mutein SKN460-C32, this protein showed resistance to plasmin (Fig. 2c). Typical processing intermediates (i.e., the 44- and 37-kDa products) observed with the natural streptokinase were not detected here. The half-lives of natural streptokinase, SKN460, and SKN460-C32 in the presence of plasmin generated during the plasminogen activation process were found to be 2, 6.4, and 43 min, respectively.
Steady-state kinetic parameters of plasminogen activation by streptokinase and its muteins.
Although the half-life of the streptokinase mutein SKN460-C32 was extended 21-fold under the in vitro condition, it is important to examine whether the amino acid changes at the N- and C-terminal regions affect the binding affinity and the ability of SKN460-C32 to activate plasminogen. Kinetic parameters for the activation of plasminogen by purified streptokinase and its derivatives (SKN460, SKC32, and SKN460-C32) were determined in three independent determinations. As shown in Table 1, the apparent Michaelis constant Km and the catalytic rate constant kp for these streptokinase proteins were comparable, indicating that these amino acid changes in streptokinase affect neither the binding nor the activation of plasminogen.
Biological activity of streptokinase and its engineered derivatives as determined by radial caseinolysis.
In the determination of the steady-state kinetic parameters of streptokinase and its derivatives, the initial velocity of the reaction was measured. The effects on the extension of the half-lives of these engineered streptokinase derivatives as plasminogen activators will not be reflected in this analysis. Plasmin-resistant streptokinase derivatives with longer half-lives would be expected to function as plasminogen activators for a longer period, and this should be reflected in the radial caseinolysis assay by showing a bigger clearing zone. In this assay, the culture supernatant with streptokinase or its derivatives was applied in equal quantity (confirmed by Western blotting) to individual wells in an agarose gel containing skim milk and plasminogen. Relative to natural streptokinase as the reference, the engineered derivatives SKN460 and SKN460-C32 showed better total activity as plasminogen activators. This was reflected by a 2.2- to 2.5-fold increase in halo size (Fig. 3). However, the streptokinase mutein, SKC32 has a halo size similar to that of the natural streptokinase.
DISCUSSION
There are several approaches to prolonging the half-life of blood clot-dissolving agents. These include the preparation of the streptokinase-acylated plasminogen complex known as APSAC (40), attachment of polyethylene glycol (5) or maltose binding protein to streptokinase (15), chemical coupling of human serum albumin to urokinase (3), and site-directed mutagenesis of glycosylation sites and domains in tissue plasminogen activator (19, 24). While some of these agents have shown promising results, others have lower activity or become heterogeneous nature because of the chemical modification. As the first step to the development of streptokinase with a longer functional half-life, we genetically engineered plasmin-resistant streptokinase. Since streptokinase is processed N-terminally between Lys59 and Ser60 and C-terminally between Lys386 and Asp387 to generate the 37-kDa intermediate which retains only 16% of the intact streptokinase activity during the plasminogen activation process (38), lysine residues in these sites are the logical targets for site-directed mutagenesis. Three versions of streptokinase were developed in this study. They either carried a single mutation that led to the conversion of lysine to glutamine (SKN460 and SKC32) or a double mutation that changed both lysine residues to glutamine (SKN460-C32). Glutamine was selected to replace lysine because the length of its side chain is comparable to that of lysine and so it should not significantly perturb the three-dimensional structure of streptokinase. It also does not introduce a positive charge to streptokinase. Therefore, plasmin with the trypsin-like substrate specificity should not cut the engineered streptokinase at these sites. This prediction was supported by our processing study (Fig. 2) and the observed increase in biological activity of SKN460 and SKN460-C32 on radial caseinolysis assays (Fig. 3). SKN460 with the change of Lys59 to glutamine allowed C-terminal processing events to proceed. The appearance of the 46-kDa (Fig. 2b, lane 1 min) and 44-kDa (Fig. 2b, 5 min to 60 min) intermediates was consistent with processing at Arg401 and Lys386, respectively. Both intact SKN460 and these intermediates were more stable and could be observed even after 60 min of reaction. This could be explained by the abolition of the rapid N-terminal processing at Lys59. These 44- to 46-kDa intermediates are expected to retain good activity for plasminogen activation since C-terminal deletion of 31 amino acid residues from streptokinase does not significantly affect the activity for plasminogen activation (18, 20). This expectation is supported by the observation of a 2.2-fold increase in the total activity of SKN460 in the radial caseinolysis assay. The faint protein band with a molecular mass around 36 kDa (Fig. 2b) could possibly be a fragment with a sequence corresponding to Ile1 to Lys332 of the intact SKN460. It was formed by processing of the 44-kDa intermediate at Lys332 and could be observed as a transiently accumulated intermediate because of the blockage of the N-terminal processing site. If it is really the case, this intermediate is unlikely to be active since residues 244 to 352 (31) and 332 to 386 (38) in streptokinase play an important role in mediating tight binding to plasminogen and residues 332, 334, and 369 to 373 are important for plasminogen activation (20, 23, 32, 50).
To block the C-terminal processing of streptokinase by plasmin at Lys386, not only was this lysine residue in SKC32 changed to glutamine but also hydrophobic amino acids located between residues 380 and 384 were converted to amino acids with hydrophilic side chains. These modifications eliminate the proteolytic cleavages within the region of 382 to 384 by residual proteases from B. subtilis WB600 during the secretory production of streptokinase. As demonstrated previously (48), these modifications do not significantly affect the activity of streptokinase. This is further supported by the determination of the steady-state kinetic parameters observed in the present study (Table 1).
The design of SKN460-C32 allows the generation of plasmin-resistant streptokinase and its production in intact form from the B. subtilis secretory production system. When both critical lysine residues were changed to glutamine, the half-life of intact streptokinase during the plasminogen activation process was greatly extended and SKN460-C32 was apparently processed at other minor processing sites without generating any transiently stable intermediates. Although both the apparent Michaelis constant and catalytic rate constant were unchanged in this mutein in reference to those of the natural streptokinase, radial caseinolysis indicated that SKN460-C32 was a better plasminogen activator. This can be explained by the prolonged half-life of SKN460-C32 as the functional plasminogen activator. The kinetic parameter measurement did not reflect any effect of prolonged half-life of SKN460-C32, since only the initial rate was determined in this type of analysis. Although replacement of Lys59 and Lys386 with glutamine does not affect either the binding or the catalytic activity of streptokinase, some lysine residues in streptokinase are essential for its function. Lysine residues at positions 256 and 257 of streptokinase are important for binding to plasminogen, and lysine residues 332 and 334 are required for catalytic activity (23).
Our results showed that only the conversion of Lys59 to glutamine was important in extending the functional half-life of streptokinase. This is consistent with the idea that C-terminal processing at Lys368 does not affect the activity of the 44-kDa intermediate to function as an efficient plasminogen activator. Many pieces of evidence indicate that the first 59 amino acids have multiple functional roles for streptokinase. Site-directed mutagenesis of Val19 (22) and Gly24 (21) inactivates streptokinase. Residues between Phe37 and Lys51 are suggested to function as a plasminogen binding site (29). The first 59 residues are also suggested to be required for stabilizing the conformation of streptokinase (38, 50). Without these N-terminal amino acids, the streptokinase fragment (residues 60 to 414) has much lower activity and shows a disordered secondary structure (50). Our study also illustrates that the plasmin-mediated proteolytic degradation of streptokinase leads only to the inactivation of streptokinase as the plasminogen activator. These cleavages are not required to convert streptokinase to the active form to mediate the plasminogen activation process. This is opposite to the case for staphylokinase, another bacterial plasminogen activator. In that situation, removal of the first 10 amino acid residues from the N terminus of staphylokinase is essential to generate the active plasminogen activator (37). Our next target is to examine the in vivo half-life and biodistribution of SKN460-C32 in the experimental animal system and its efficiency in clot lysis.
ACKNOWLEDGMENTS
We thank Canada Red Cross at Calgary for heparinized blood and David A. Hart (Department of Microbiology and Infectious Diseases, University of Calgary) for advice in the preparation of human Glu-plasminogen. Sequence determination for some of the mutated streptokinase genes by Louise Tran is greatly appreciated.
This work was supported by a strategic grant from the Natural Sciences and Engineering Research Council of Canada. S.-L. Wong is a senior medical scholar of the Alberta Heritage Foundation for Medical Research.
REFERENCES
- 1.Bajaj A P, Castellino F J. Activation of human plasminogen by equimolar levels of streptokinase. J Biol Chem. 1977;252:492–498. [PubMed] [Google Scholar]
- 2.Bradford M M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein dye binding. Anal Biochem. 1976;72:248–254. doi: 10.1016/0003-2697(76)90527-3. [DOI] [PubMed] [Google Scholar]
- 3.Breton J, Pezzi N, Molinari A, Bonomini L, Lansen J, Gonzalez De Buitrago G, Prieto I. Prolonged half-life in the circulation of a chemical conjugate between a pro-urokinase derivative and human serum albumin. Eur J Biochem. 1995;231:563–569. doi: 10.1111/j.1432-1033.1995.tb20733.x. [DOI] [PubMed] [Google Scholar]
- 4.Brockway W J, Castellino F J. A characterization of native streptokinase and altered streptokinase isolated from a human plasminogen activator complex. Biochemistry. 1974;13:2063–2070. doi: 10.1021/bi00707a010. [DOI] [PubMed] [Google Scholar]
- 5.Brucato F H, Pizzo S V. Catabolism of streptokinase and polyethylene glycol-streptokinase: evidence for transport of intact forms through the biliary system in the mouse. Blood. 1990;76:73–79. [PubMed] [Google Scholar]
- 6.Cannon C P, Goldhaber S Z. The importance of rapidly treating patients with acute myocardial infarction. Chest. 1995;107:598–600. doi: 10.1378/chest.107.3.598. [DOI] [PubMed] [Google Scholar]
- 7.Castellino F J, Sodetz J M, Brockway W J, Siefring G E., Jr Streptokinase. Methods Enzymol. 1976;45:244–257. doi: 10.1016/s0076-6879(76)45024-3. [DOI] [PubMed] [Google Scholar]
- 8.Davidson D J, Higgins D L, Castellino F J. Plasminogen activator activities of equimolar complexes of streptokinase with variant recombinant plasminogens. Biochemistry. 1990;29:3585–3590. doi: 10.1021/bi00466a023. [DOI] [PubMed] [Google Scholar]
- 9.Deutsch D G, Mertz E T. Plasminogen: purification from human plasma by affinity chromatography. Science. 1970;170:1095–1096. doi: 10.1126/science.170.3962.1095. [DOI] [PubMed] [Google Scholar]
- 10.Gruppo Italiano Per Lo Studio Della Sopravvivenza Nell’Infarto Miocardico. GISSI-2: a factorial randomised trial of alteplase versus streptokinase and heparin versus no heparin among 12,490 patients with acute myocardial infarction. Lancet. 1990;336:65–71. [PubMed] [Google Scholar]
- 11.GUSTO Angiographic Investigators. The effects of tissue plasminogen activator, streptokinase, or both on coronary-artery patency, ventricular function, and survival after acute myocardial infarction. N Engl J Med. 1993;329:1615–1622. doi: 10.1056/NEJM199311253292204. [DOI] [PubMed] [Google Scholar]
- 11a.GUSTO Angiographic Investigators. An international randomized trial comparing four thrombolytic strategies for acute myocardial infarction. N Engl J Med. 1993;329:673–682. doi: 10.1056/NEJM199309023291001. [DOI] [PubMed] [Google Scholar]
- 12.Halling S M, Sanchez-Anzaldo F J, Fukuda R, Doi R H, Meares C F. Zinc is associated with the beta subunit of DNA dependent RNA polymerase of Bacillus subtilis. Biochemistry. 1977;16:2880–2884. doi: 10.1021/bi00632a012. [DOI] [PubMed] [Google Scholar]
- 13.Hemsley A, Arnheim N, Toney M D, Cortopassi G, Galas D J. A simple method for site-directed mutagenesis using the polymerase chain reaction. Nucleic Acids Res. 1989;17:6545–6551. doi: 10.1093/nar/17.16.6545. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Hennekens C H, O’Donnell C J, Ridker P M, Marder V J. Current issues concerning thrombolytic therapy for acute myocardial infarction. J Am Coll Cardiol. 1995;25:18S–22S. doi: 10.1016/0735-1097(95)00107-f. [DOI] [PubMed] [Google Scholar]
- 15.Houng A, Quen S, Jean L-F, Reed G L. Construction of a recombinant streptokinase that resists cleavage and inactivation by plasmin. Thromb Haemostasis. 1995;73:1130. . (Abstract.) [Google Scholar]
- 16.Huber K, Maurer G. Thrombolytic therapy in acute myocardial infarction. Semin Thromb Hemostasis. 1996;22:15–26. doi: 10.1055/s-2007-998988. [DOI] [PubMed] [Google Scholar]
- 17.ISIS-3 Collaborative Group. ISIS-3: A randomised comparison of streptokinase vs tissue plasminogen activator vs anistreplase and of aspirin plus heparin vs aspirin alone among 41 299 cases of suspected acute myocardial infarction. Lancet. 1992;339:753–770. [PubMed] [Google Scholar]
- 18.Jackson K W, Malke H, Gerlach D, Ferretti J J, Tang J. Active streptokinase from the cloned gene in Streptococcus sanguis is without the carboxyl-terminal 32 residues. Biochemistry. 1986;25:108–114. doi: 10.1021/bi00349a016. [DOI] [PubMed] [Google Scholar]
- 19.Keyt B A, Paoni N F, Refino C J, Berleau L, Nguyen H, Chow A, Lai J, Peña L, Pater C, Ogez J. A faster-acting and more potent form of tissue plasminogen activator. Proc Natl Acad Sci USA. 1994;91:3670–3674. doi: 10.1073/pnas.91.9.3670. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Kim I C, Kim J S, Lee S H, Byun S M. C-terminal peptide of streptokinase, Met369-Pro373, is important in plasminogen activation. Biochem Mol Biol Int. 1996;40:939–945. doi: 10.1080/15216549600201563. [DOI] [PubMed] [Google Scholar]
- 21.Lee B R, Park S K, Kim J H, Byun S M. Site-specific alteration of Gly-24 in streptokinase: its effect on plasminogen activation. Biochem Biophys Res Commun. 1989;165:1085–1090. doi: 10.1016/0006-291x(89)92713-7. [DOI] [PubMed] [Google Scholar]
- 22.Lee S H, Jeong S T, Kim I C, Byun S M. Identification of the functional importance of valine-19 residue in streptokinase by N-terminal deletion and site-directed mutagenesis. Biochem Mol Biol Int. 1997;41:199–207. doi: 10.1080/15216549700201201. [DOI] [PubMed] [Google Scholar]
- 23.Lin L F, Oeun S, Houng A, Reed G L. Mutation of lysines in a plasminogen binding region of streptokinase identifies residues important for generating a functional activator complex. Biochemistry. 1996;35:16879–16885. doi: 10.1021/bi961531w. [DOI] [PubMed] [Google Scholar]
- 24.Madison E. Probing structure-function relationships of tissue-plasminogen activator by site-specific mutagenesis. Fibrinolysis. 1994;8:221–236. doi: 10.1016/0076-6879(93)23050-w. [DOI] [PubMed] [Google Scholar]
- 25.Malke H, Ferretti J J. Streptokinase: cloning, expression, and excretion by Escherichia coli. Proc Natl Acad Sci USA. 1984;81:3557–3561. doi: 10.1073/pnas.81.11.3557. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Matsudaira P. Sequence from picomole quantities of proteins electroblotted onto polyvinylidene difluoride membranes. J Biol Chem. 1987;262:10035–10038. [PubMed] [Google Scholar]
- 27.Maynard C, Althouse R, Olsufka M, Ritchie J L, Davis K B, Kennedy J W. Early versus late hospital arrival for acute myocardial infarction in the Western Washington Thrombolytic Therapy Trials. Am J Cardiol. 1989;63:1296–1300. doi: 10.1016/0002-9149(89)91038-2. [DOI] [PubMed] [Google Scholar]
- 28.McClinock D K, Englert M E, Dziobkowski C, Snedeker E H, Bell P H. Two distinct pathways of the streptokinase-mediated activation of highly purified human plasminogen. Biochemistry. 1974;13:5334–5344. doi: 10.1021/bi00723a013. [DOI] [PubMed] [Google Scholar]
- 29.Nihalani D, Sahni G. Streptokinase contains two independent plasminogen-binding sites. Biochem Biophys Res Commun. 1995;217:1245–1254. doi: 10.1006/bbrc.1995.2902. [DOI] [PubMed] [Google Scholar]
- 30.Rawles J. Halving of mortality at 1 year by domiciliary thrombolysis in the Grampian Region Early Anistreplase Trial (GREAT) J Am Coll Cardiol. 1994;23:1–5. doi: 10.1016/0735-1097(94)90494-4. [DOI] [PubMed] [Google Scholar]
- 31.Reed G L, Lin L-F, Parhami-Seren B, Kussie P. Identification of a plasminogen binding region in streptokinase that is necessary for the creation of a functional streptokinase-plasminogen activator complex. Biochemistry. 1995;34:10266–10271. doi: 10.1021/bi00032a021. [DOI] [PubMed] [Google Scholar]
- 32.Rodríguez P, Fuentes P, Barro M, Alvarez J G, Muñoz E, Collen D, Lijnen H R. Structural domains of streptokinase involved in the interaction with plasminogen. Eur J Biochem. 1995;229:83–90. doi: 10.1111/j.1432-1033.1995.tb20441.x. [DOI] [PubMed] [Google Scholar]
- 33.Rozenman Y, Gotsman M, Weiss T, Lotan C, Mosseri M, Sapoznikov D, Welber S, Nassar H, Hasin Y, Gilon D. Very early thrombolysis in acute myocardial infarction—a light at the end of the tunnel. Isr J Med Sci. 1994;30:99–107. [PubMed] [Google Scholar]
- 34.Rozenman, Y., M. S. Gotsman, A. T. Weiss, C. Lotan, M. Mosseri, D. Sapoznikov, S. Welber, Y. Hasin, and D. Gilon. 1995. Early intravenous thrombolysis in acute myocardial infarction: the Jerusalem experience. Int. J. Cardiol. 49(Suppl.):S21–S28. [DOI] [PubMed]
- 35.Saiki R K, Gelfand D H, Stoffel S, Scharf S J, Higuchi R, Horn G T, Mullis K B, Erlich H A. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science. 1988;239:487–491. doi: 10.1126/science.2448875. [DOI] [PubMed] [Google Scholar]
- 36.Saksela O. Radial caseinolysis in agarose: a simple method for detection of plasminogen activators in the presence of inhibitory substances and serum. Anal Biochem. 1981;111:276–282. doi: 10.1016/0003-2697(81)90564-9. [DOI] [PubMed] [Google Scholar]
- 37.Schlott B, Guhrs K H, Hartmann M, Rocker A, Collen D. Staphylokinase requires NH2-terminal proteolysis for plasminogen activation. J Biol Chem. 1997;272:6067–6072. doi: 10.1074/jbc.272.9.6067. [DOI] [PubMed] [Google Scholar]
- 38.Shi G-Y, Chang B-I, Chen S-M, Wu D-H, Wu H-L. Function of streptokinase fragments in plasminogen activation. Biochem J. 1994;304:235–241. doi: 10.1042/bj3040235. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Siefring G E, Jr, Castellino F J. Interaction of streptokinase with plasminogen: isolation and characterization of a streptokinase degradation product. J Biol Chem. 1976;251:3913–3920. [PubMed] [Google Scholar]
- 40.Smith R A, Dupe R J, English P D, Green J. Fibrinolysis with acyl-enzymes: a new approach to thrombolytic therapy. Nature. 1981;290:505–508. doi: 10.1038/290505a0. [DOI] [PubMed] [Google Scholar]
- 41.Steinmetz M, LeCoq D, Aymerich S, Gonzy-Treboul G, Gay P. The DNA sequence of the secreted Bacillus subtilis enzyme levansucrase and its genetic control sites. Mol Gen Genet. 1985;200:220–228. doi: 10.1007/BF00425427. [DOI] [PubMed] [Google Scholar]
- 42.Summaria L, Arzadon L, Bernabe P, Robbins K C, Barlow G. Characterization of the NH2-terminal glutamic acid and NH2-terminal lysine forms of human plasminogen isolated by affinity chromatography and isoelectric focusing methods. J Biol Chem. 1973;248:2984–2991. [PubMed] [Google Scholar]
- 43.Wang L-F, Doi R H. Promoter switch during development and the termination site of the ς43 operon of Bacillus subtilis. Mol Gen Genet. 1987;207:114–119. doi: 10.1007/BF00331498. [DOI] [PubMed] [Google Scholar]
- 44.Weaver W D, Cerqueira M, Hallstrom A P, Litwin P E, Martin J S, Kudenchuk P J, Eisenberg M. The Myocardial Infarction Triage and Intervention Project Group: prehospital-initiated vs hospital-initiated thrombolytic therapy. The Myocardial Infarction Triage and Intervention Trial. JAMA. 1993;270:1211–1216. [PubMed] [Google Scholar]
- 45.Weinstein M J, Doolittle R F. Differential specificities of thrombin, plasmin and trypsin with regard to synthetic and natural substrates and inhibitors. Biochim Biophys Acta. 1972;258:577–582. doi: 10.1016/0005-2744(72)90250-1. [DOI] [PubMed] [Google Scholar]
- 46.Wohl R C, Summaria L, Robbins K C. Kinetics of activation of human plasminogen by different activator species at pH 7.4 and 37 degrees C. J Biol Chem. 1980;255:2005–2013. [PubMed] [Google Scholar]
- 47.Wong S-L. Development of an inducible and enhancible expression and secretion system in Bacillus subtilis. Gene. 1989;83:215–223. doi: 10.1016/0378-1119(89)90107-8. [DOI] [PubMed] [Google Scholar]
- 48.Wong S-L, Ye R, Nathoo S. Engineering and production of streptokinase in a Bacillus subtilis expression-secretion system. Appl Environ Microbiol. 1994;60:517–523. doi: 10.1128/aem.60.2.517-523.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Wu X-C, Lee W, Tran L, Wong S-L. Engineering a Bacillus subtilis expression-secretion system with a strain deficient in six extracellular proteases. J Bacteriol. 1991;173:4952–4958. doi: 10.1128/jb.173.16.4952-4958.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Young K-C, Shi G-Y, Chang Y-F, Chang B-I, Chang L-C, Lai M-D, Chuang W-J, Wu H-L. Interaction of streptokinase and plasminogen—studied with truncated streptokinase peptides. J Biol Chem. 1995;270:29601–29606. doi: 10.1074/jbc.270.49.29601. [DOI] [PubMed] [Google Scholar]



