Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
| Test target | Target gene | Sequences of primers (5’-3’) | Amplified segment (bp) | Reference |
|---|---|---|---|---|
| Salmonella spp. | invA1 | GTGAAATTATCGCCACGTTCGGGCAA | 284 | [25] |
| TCATCGCACCGTCAAAGGAACC | ||||
| Clostridium spp. | 16S rRNA 2 | AAAGATGGCATCATCATTCAAC | 360 | [26] |
| TACCGTCATTATCTTCCCCAAA |
invA1: invasion of the host epithelial cells (Conserved virulence gene), 16S rRNA2: Clostridium spp. Conserved gene.
