Skip to main content
NCBI home page
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 1998 Jul;64(7):2490–2496. doi: 10.1128/aem.64.7.2490-2496.1998

Construction and Expression of a Bifunctional Single-Chain Antibody against Bacillus cereus Spores†

Kai Koo 1, Peggy M Foegeding 1,*, Harold E Swaisgood 1
PMCID: PMC106416  PMID: 9647820

Abstract

The variable-region genes of monoclonal antibody against Bacillus cereus spores were cloned from mouse hybridoma cells by reverse transcription-PCR. The heavy- and light-chain variable-region genes were connected by a 45-base linker DNA to allow folding of the fusion protein into a functional tertiary structure. For detection of protein expression, a 10-amino-acid strep tag (biotin-like peptide) was attached to the C terminus of recombinant antibody as the reporter peptide. The single-chain antibody construct was inserted into the expression vector and expressed in Escherichia coli under the control of the T7 RNA polymerase-T7 promoter expression system. The expressed single-chain antibody was detected on Western blots by using a streptavidin-conjugated enzyme system. This small recombinant antibody fragment (ca. 28,000 Da by calculation) had B. cereus spore binding ability and antigen specificity similar to those of its parent native monoclonal antibody.

Bacillus cereus spores are common in the environment and a variety of foods, including dairy foods (12). They can survive mild heat treatment and outgrow to form vegetative cells in a suitable environment. B. cereus can cause food-borne illness, may grow at refrigeration temperatures, and may cause food spoilage (9). Control of these bacterial spores in food processing is important to ensure the safety and a long shelf life of foods.

To maintain the quality and safety of foods, polyclonal and monoclonal antibodies have been tested as a tool for quality control. They have been increasingly recognized for their value in the detection of microorganisms, contaminants, and toxins in food systems (26). In this decade, active monoclonal antibody fragments have been synthesized by microbial expression systems (3, 41). This technological breakthrough has facilitated industrial applications of antibodies at a more reasonable cost. Recently, the versatility of recombinant antibody fragments for use in clinical diagnoses (7, 44), protein purification (2, 6), or food pathogen binding (30) has been demonstrated. These antibodies are likely to further enhance applications of antibodies in investigations in applied and environmental microbiology, because they should be relatively inexpensive and readily available.

Recombinant antibodies contain the variable regions of the heavy- and light-chain domains that can associate into an antigen binding unit in vivo (41). The average size of a recombinant antibody is approximately 30,000 Da, which is only one-fifth of a normal immunoglobulin G (IgG) molecule. These antibodies have an affinity for antigen that is similar to or slightly lower than that of their parent monoclonal antibodies (3, 16, 41, 44). However, the heavy and light chains of the recombinant protein may dissociate and have limited stability at low protein concentrations (14), because the intermolecular disulfide bonds that linked the heavy and light chains of native antibody do not exist. To prevent this problem, a short linker peptide has been used (16) to connect the domains of the heavy- and light-chain variable regions and to form a single-chain antibody. This design allows recombinant antibody to fold into the correct conformation and increases its stability in many applications (14). Huston et al. (17) indicated that the peptide linker should span at least 3.5 nm between the two domains to maintain the correct conformation. This length is approximately that of a 10-amino-acid peptide; however, a peptide of 14 to 15 amino acids seems to be an optimal linker for single-chain antibody. The glycine-serine peptide linker (17) that contains 3 U of (Gly)4-Ser linkage is one popular choice for construction of single-chain antibody.

In the mammalian immune system, the antibody-synthesizing B cells rearrange their immunoglobulin biosynthesis genes before they produce specific antibodies. The intron sequences are removed from the transcribed RNA and form the mature mRNA for antibody expression (15). Different strategies have been developed for cloning the immunoglobulin genes (16, 32). For example, reverse transcription-PCR (RT-PCR) allows direct cloning and synthesis of rearranged immunoglobulin variable-region genes. The mRNA isolated from hybridoma cells can be used as the template for cDNA synthesis, and the target cDNA that encodes the antibody gene can be amplified by PCR. Thus, selection and enrichment of immunoglobulin variable-region genes can be finished within a few hours.

Strep tag is a 10-amino-acid peptide that binds to streptavidin through a biotin-streptavidin-like interaction (39). Strep tag-fused proteins can be recovered directly from cell lysates by single-step affinity chromatography with an immobilized streptavidin column (40) and can be detected directly by a streptavidin-conjugated enzyme system (39). In the present study, the genes encoding the variable regions of a monoclonal anti-B. cereus spore IgG were cloned by RT-PCR and constructed into a fusion protein gene. The strep tag sequence was joined to the construct to form a bifunctional single-chain antibody gene. The RT-PCR cloning strategy, gene modification, vector construction, protein expression, and functional assays used are presented and discussed.

MATERIALS AND METHODS

Hybridomas, bacterial spores, and cells.

Hybridoma cell lines that produce the monoclonal antibody against B. cereus T spores were previously screened in our laboratory (35). The myeloma cell line X63-Ag8.653 (20) was used as the fusion partner. The hybridoma culture and native monoclonal antibody tissue culture supernatant were prepared by the College of Veterinary Medicine, North Carolina State University. Escherichia coli JM109 {endA1 recA1 gyrA96 thi hsdR17 (rk−, mk+) relA1 supE44 Δ(lac-proAB) [F′ traΔ36 proAB lacIqZΔM15]} was purchased from Promega (Madison, Wis.). E. coli BL21 (DE3), which carries the T7 RNA polymerase gene under the lacUV5 promoter control, was purchased from Novagen (Madison, Wis.). Competent E. coli cells used for gene transformation were prepared by the polyethylene glycol-dimethyl sulfoxide protocol described by Chung et al. (10). Vegetative cells of B. cereus T were grown in Trypticase soy broth at 30°C for 12 h. Spores of B. cereus T were prepared on fortified nutrient agar sporulation medium (18). Bacillus subtilis A, B. subtilis subsp. globigii, Bacillus megaterium, Bacillus stearothermophilus, and Clostridium perfringens spores were obtained and prepared as described by Quinlan and Foegeding (35).

RNA isolation, cDNA synthesis, and amplification.

Cytoplasmic RNA was prepared from 3 × 106 hybridoma cells by an organic solvent extraction (38). The cell membrane was lysed by mixing with RNA extraction solution (0.14 M NaCl, 1.5 mM MgCl2, 0.5% [vol/vol] Nonidet P-40 [Sigma, St. Louis, Mo.], and 400 U of RNasin [Promega] per ml in 0.01 M Tris buffer [pH 8.6]), gently vortexing for 15 s, and incubating in an ice bath for 5 min. After centrifugation of the lysate, the supernatant was treated with proteinase K-sodium dodecyl sulfate (SDS) solution (0.6 mg of proteinase K [GIBCO BRL, Gaithersburg, Md.] per ml, 2% SDS [wt/vol], 5 mM EDTA in 10 mM Tris buffer [pH 7.4]) for 20 min at room temperature. The RNA was extracted with phenol-chloroform (1:1) solution and precipitated with isopropanol. After the RNA pellet was washed with 70% ethanol, the pellet was air dried and dissolved in diethyl pyrocarbonate-treated distilled water. The RNA was used as a template for first-strand cDNA synthesis with 3′ primers specific for the mouse IgG genes (Novagen catalog no. 69831-1). The cDNA fragments were amplified by PCR with Taq DNA polymerase (Promega) and 3′ and 5′ primers from the mouse Ig primer set (Novagen catalog no. 69831-1). The PCR was performed with a Perkin-Elmer DNA Thermal Cycler 480 (Norwalk, Conn.). Parameters for DNA amplification of antibody variable-region genes followed the suggestions from the primer manufacturer (Ig-Prime kit protocols; Novagen).

Because each 5′-primer contained a SalI or EcoRI site and each 3′-primer contained a HindIII site, the PCR products were digested with SalI and HindIII or EcoRI and HindIII combinations and ligated into the pGEM-3Z (Promega) cloning vector for DNA sequencing and further gene construction.

DNA manipulation and sequencing.

The basic molecular biology operations as described by Maloy (28) were used. The DNA sequences of the RT-PCR product and fusion protein gene were determined by the cycle sequencing method (24) with a nonradioactive silver-staining protocol (1). DNA-sequencing-grade Taq DNA polymerase, nucleotides, and silver-staining reagents were obtained from Promega. The DNA sequence of the single-chain antibody gene was determined in both directions.

Construction of expression vectors. (i) Plasmid DNA and oligonucleotides.

Plasmid pGEM-3Z for general cloning and sequencing purposes was provided by Promega. The vector pET22b(+), containing a tightly controlled T7/lac promoter for regulation of fusion protein expression (42), was purchased from Novagen. The oligonucleotides used as PCR primers or for DNA sequencing were synthesized by either the Molecular Biology Center, North Carolina State University, Genosys Biotechnologies, Inc. (Woodlands, Tex.), or GIBCO BRL.

(ii) Construction of cloning vector.

A 160-base, XbaI/HindIII-digested DNA fragment from the pET22b(+) plasmid that contained the pelB signal peptide sequence and NgoMI and HindIII restriction enzyme sites was ligated into the cloning vector pGEM-3Z. The new cloning vector, pGEM-3ZpelB, was used as a tool for construction of the single-chain antibody gene.

(iii) Preparation of single-chain antibody construct.

The PCR-derived DNA fragments that encoded the antibody variable-region genes were modified by second-round PCR to generate unique restriction enzyme sites for connection of heavy- and light-chain genes to give a single fusion protein gene. The sequences of oligonucleotides that were used in this gene construction are shown in Table 1. The primers NgoHF and SalHF were used for modification of the variable-region heavy-chain gene. A long primer, Lklinker (72 bp), was used to introduce a SalI restriction enzyme site and a 45-base linker DNA which encoded 3 U of (Gly)4-Ser to the 5′ end of the light-chain variable gene. The LStreptag primer containing a HindIII restriction enzyme site and the strep tag sequence (39) was designed to generate the strep tag-conjugated variable-region light-chain gene.

TABLE 1.

Oligonucleotide sequences of PCR primers used for modification of immunoglobulin variable-region genesa

Primer Nucleotide sequence (5′-3′)b PCR no.c
NgoHF ATTAGCCGGCGATGGCCGAGGTGCAGCTGGTGGA 3
SalHF TGTCGTGTCGACTGAGGA 3
Lklinker ATCGGTCGACGGTGGTGGTGGTTCCGGTGGTGGTGGTTCCGGTGGTGGTGGTTCCCAAATTGTTCTCACCCA 4
LStreptag CGATAAGCTTAACCACCGAACTGCGGGTGACGCCAAGCGGATGGTGGGAAGATGGATAC 4
Open in a new tab
a

The sequences of primers used in RT-PCR 1 and RT-PCR 2 were described in Novagen’s Ig-prime kit protocols. 

b

The restriction enzyme site is underlined. 

c

PCR steps are depicted in Fig. 1. 

Expression of fusion protein.

Plasmid DNA, which contained the single-chain antibody gene, was transformed into E. coli BL21 (DE3). Transformants were inoculated in LB medium (28) containing ampicillin (100 μg/ml). The seed culture was transferred into plasmid medium (28) containing ampicillin (500 μg/ml), and the medium was incubated for 5 h at 37°C with shaking; protein expression was induced by adding 0.2 mM isopropyl-β-d-thiogalactopyranoside (IPTG; GIBCO BRL) for 2 h at 37°C.

Protein fractionation and recovery.

To determine fusion protein expression efficiency, cells from 1 ml of culture were collected by centrifugation. For extraction of periplasmic proteins, an osmotic shock method (31) was used. The cells were harvested by centrifugation, and the pellet was resuspended in ice-cold 1 mM EDTA–50 mM Tris buffer (pH 8.0) in a 20% sucrose solution with gentle shaking for 10 min and then centrifuged at 10,000 × g, for 10 min at 4°C. The supernatant was collected, and the cell pellet was resuspended in ice-cold 5 mM MgSO4. After gentle shaking for 10 min in an ice bath, the cells were centrifuged at 10,000 × g for 10 min at 4°C. Both supernatants (Tris-sucrose and MgSO4 extractions) which should have contained the osmotic shock proteins were combined. For monitoring the efficiency of periplasmic proteins extracted by the osmotic shock protocol, β-lactamase was used as a periplasmic marker enzyme (41). The activities of β-lactamase in different extractions were determined as described by Ross and O’Callaghan (37). To evaluate the remaining cytoplasmic proteins and the insoluble cellular fraction, the cell pellet (collected by centrifugation after osmotic shock extraction) was resuspended in 0.05 M Tris buffer (pH 8.0)–2 mM EDTA and lysed with lysozyme for 15 min at room temperature. The viscous mixture was sonicated for 20 s and then centrifuged to separate the cytoplasmic fraction from the insoluble membrane fraction. The insoluble cellular fraction, which contained the membrane proteins and inclusion bodies, was solubilized in 6 M guanidine-HCl in 0.1 M Tris buffer (pH 8.0) at 4°C overnight or at room temperature for 1 h, and then the guanidine-HCl-solubilized fraction was centrifuged at 10,000 × g for 10 min at 4°C to remove any precipitate before dialyzing against phosphate buffer (0.02 M Na-phosphate, 0.8% NaCl [pH 7.8]). The dialyzed solution was centrifuged to remove any possible precipitate and was stored at −20°C. The total protein concentration of the final solubilized cellular fraction from the E. coli culture was determined by the Bradford dye-binding method (5) with bovine gamma globulin (Bio-Rad, Hercules, Calif.) used as the protein standard.

Each fraction recovered from the cell culture was analyzed by SDS–12% polyacrylamide gel electrophoresis (PAGE) under reducing conditions. The percentages of single-chain antibody in the total protein and final solubilized cellular fractions were quantitated from SDS-PAGE gels by using a Personal Densitometer SI and FragmeNT software (Molecular Dynamic, Sunnyvale, Calif.).

Western blot and N-terminal sequencing of the single-chain antibody.

The procedures of Western blot analysis were modified from the original protocol described by Towbin et al. (43). Proteins on the polyacrylamide gel were transferred to an Immobilon P membrane (Millipore, Bedford, Mass.). The membrane-bound single-chain antibody was probed directly by streptavidin-conjugated horseradish peroxidase (Sigma catalog no. S5512). The enzyme activity was detected with the 3-amino-9-ethylcarbazole (AEC) chromogen kit (Biomeda, Foster City, Calif.). For protein sequencing, a protein-sequencing-grade polyvinylidene difluoride membrane (Bio-Rad) was used for the Western blot. Proteins in the final solubilized cellular fraction were electrophoretically blotted to the membrane and cleaned by washing with doubly distilled water. After staining with Coomassie brilliant blue R-250, the band containing the single-chain antibody was excised and sequenced. The first seven amino acids of this fusion protein were determined by a microsequencing method at the Medical Center, University of North Carolina at Chapel Hill.

Dot blot immunoassay.

The procedures used for dot blotting were modified from the protocol described by Phillips (34). Fifty microliters of bacterial spore suspension (approximately 108 spores or cells/ml) was applied into each well of a dot blotter (Bio-Rad) and filtered with an Immobilon P membrane (Millipore). The nonspecific binding sites of spores or cells and the blotting membrane were blocked by 1% bovine serum albumin in phosphate-buffered saline (PBS). One hundred microliters of antibody solution was added (approximately 2 to 4 μg of antibody), and the mixture was incubated for 40 min at room temperature. Unbound antibody was removed by washing with TPBS (0.05% Tween 20 [vol/vol] in PBS). The amount of bound native monoclonal antibody was determined with a biotinylated anti-mouse IgG–avidin-horseradish peroxidase conjugate detection system (Biomeda). The bound strep tag-conjugated single-chain antibody was probed directly by applying streptavidin-conjugated horseradish peroxidase (Sigma catalog no. S5512). The AEC chromogen kit (Biomeda) or 4-chloro-1-naphthol (Bio-Rad) was used to detect peroxidase activity.

Functional assays.

Two functional parameters of the single-chain antibody were checked by a dot blot immunoassay method. The hybridoma cell culture supernatant containing parent native monoclonal antibody (35) was used as a control.

(i) Antigen specificity test.

The antigen specificities of native monoclonal and single-chain antibodies were determined by the dot blot method described above. Spores of six species were examined in this assay.

(ii) Sensitivity test.

Different concentrations of B. cereus spores (106 to 108 spores/ml) were used to compare the detection sensitivity of the two types of antibodies.

RESULTS

Cloning of immunoglobulin variable-region genes.

A schematic of the cloning procedure used is presented in Fig. 1. To clone these variable-region genes whose sequences were unknown, a total of 14 groups of degenerate 5′ cloning primers were used. The size of the variable-region gene should range from 430 to 450 bp. This would contain the full length of the variable-region gene, the signal peptide, and part of the constant-region domain sequences. Three groups of RT-PCR-amplified DNA fragments of the appropriate sizes were detected by agarose gel electrophoresis from three different primer groups. One DNA band was derived from the heavy-chain primer group, while the others came from two different κ light-chain primers. DNA sequencing revealed that the heavy-chain and one of the light-chain DNA fragments were derived from B cells. The third DNA fragment was a nonfunctional gene fragment originally from the fusion partner. Because the hybridoma cells were derived from the MOPC-21 family myeloma cell line, such as X63-Ag8.653, they always transcribed three different rearranged immunoglobulin mRNAs (8). Two of them encoded the functional genes of the immunoglobulin heavy and light chains. The third one was a nonfunctional light-chain gene derived from the fusion partner. The heavy- and light-chain variable-region DNA fragments derived from B cells were selected for the single-chain-antibody gene construction. For construction of a strep tag-attached, single-chain antibody gene, four new primers, i.e., NgoHF, SalHF, Lklinker, and LStreptag (Table 1), were designed and used in PCR 3 and PCR 4 (Fig. 1).

FIG. 1.

FIG. 1

Open in a new tab

Schematic of cloning of immunoglobulin variable-region genes from hybridoma cells. FR, framework region.

Construction of the single-chain antibody gene and its expression vector.

The procedures used for fusion protein gene construction are shown in Fig. 2. The newly synthesized heavy-chain variable-region genes were modified by the introduction of unique NgoMI and SalI restriction enzyme sites at the ends of the gene fragment. The PCR-modified light-chain variable-region gene contained a 45-bp linker DNA for connection to the heavy-chain gene and a strep tag sequence at the end of the gene for streptavidin binding. The pET22b(+) plasmid DNA that contained a tightly controlled T7-lac promoter and a pelB signal sequence (21) for fusion protein expression and translocation was chosen as the expression vector in this study. The NgoMI restriction enzyme site in pET22b(+), which was located at the end of the pelB signal sequence, was considered an ideal position for insertion of the fusion protein gene into the vector. However, because there are five NgoMI sites in the pET22b(+) vector, it was very difficult to directly insert the gene fragment into a specific NgoMI site of pET22b(+). To overcome this problem, the pGEM-3Z-derived pGEM-3ZpelB plasmid DNA, which contains multiple cloning sites compatible with the pET22b(+) vector, was constructed and served as a workhorse vector for gene assembly and DNA sequencing (Fig. 3A). The PCR-modified variable-region heavy- and light-chain genes were inserted into the pGEM-3ZpelB vector sequentially to form a pGEM-3ZIgTag plasmid DNA. To monitor replication fidelity, the DNA sequence of this fusion gene was determined and was found to be identical to that from the first RT-PCR. The 0.9-kb XbaI/HindIII-digested DNA fragment from the pGEM-3ZIgTag that encoded the complete fusion protein gene was introduced into pET22b(+). The final fusion protein expression vector was called pET22IgTag (Fig. 3B). The DNA sequence of the complete single-chain antibody is shown in Fig. 4.

FIG. 2.

FIG. 2

Open in a new tab

Schematic illustrating construction of strep tag-conjugated single-chain-antibody fusion gene and expression vector.

FIG. 3.

FIG. 3

Open in a new tab

Maps of cloning and expression vectors. (A) pGEM-3ZpelB cloning vector. (B) pET22IgTag expression vector. pelB, pelB signal peptide sequence; lac p/o, lac promoter and operator.

FIG. 4.

FIG. 4

Open in a new tab

Nucleotide and deduced amino acid sequences of the single-chain anti-B. cereus T spore antibody. FR, framework region; CDR, complementarity-determining region; CL, light-chain constant region. For accuracy, both strands of the DNA were sequenced.

Protein analysis.

The fusion protein gene was expressed successfully in E. coli BL21 (DE3) by using the T7 RNA polymerase-T7 promoter expression system and was induced by 0.2 mM isopropyl-β-d-thiogalactopyranoside (IPTG). The total time from transferring the overnight seed culture into fresh plasmid medium to the recovery of the dialyzed soluble fusion protein was about 24 h. SDS-PAGE and Western blot analyses (Fig. 5) showed that no fusion protein was detectable in the noninduced culture (Fig. 5, lane 1). Protein fractionation analysis indicated that almost all of the fusion proteins were detected in the final solubilized cellular fraction (Fig. 5, lane 5). Although periplasmic marker enzyme analysis showed that approximately 80% of total β-lactamase activity was found in osmotic shock extraction, fusion protein was not detected in the soluble fractions (Fig. 5, lane 3 and 4). SDS-PAGE analysis showed that the final solubilized cellular fraction contained only one main band; Western blotting indicated that it was the strep tag-conjugated single-chain antibody. Densitometry data suggested that as much as 90% of the protein in the final solubilized cellular fraction was the single-chain antibody. In this system, approximately 10 mg of fusion protein of soluble strep tag-conjugated single-chain antibody per liter of culture was produced.

FIG. 5.

FIG. 5

Open in a new tab

Protein fractionation analysis of strep tag-conjugated, single-chain anti-B. cereus T antibody. (A) SDS-12% PAGE. The gel was stained with 0.25% Coomassie brilliant blue R-250. (B) Western blot. Fusion protein was probed with streptavidin-conjugated peroxidase (Sigma catalog no. S5512). Lanes: MW, molecular weight standards; 1, total cell sample (without IPTG induction); 2, total cell sample (under 0.2 mM IPTG induction); 3, osmotic shock fraction; 4, cytoplasmic fraction; and 5, final solubilized cellular fraction.

The N-terminal sequence of the first 7 amino acids from this strep tag-conjugated single-chain antibody was Glu-Val-Gln-Leu-Val-Asp-Ser. This result is different from the protein sequence of the pelB signal peptide, but it matched the amino acid sequence of the mature single-chain antibody predicted from the DNA sequence (Fig. 4). This indicated that the pelB signal peptide had been cleaved correctly by E. coli and that the mature fusion protein existed in E. coli but was aggregated.

Binding properties of monoclonal antibody and single-chain antibody.

This single-chain antibody contained the strep tag, a biotin-like short peptide. It was easily detected by streptavidin-conjugated horseradish peroxidase. Thus, the use of a specific antibody to probe the target protein was not necessary. This bifunctional design simplified detection of the fusion protein in Western blots and dot blot immunoassays. Six species of Bacillus and Clostridium spores were used in the dot blot immunoassay to compare the antigen specificities between the single-chain antibody and its parent monoclonal antibody. The two antibodies revealed similar spore binding behaviors. However, some unexpected cross-reactions with the spores of B. subtilis A and C. perfringens were detected from the single-chain antibody but not the native monoclonal antibody (Table 2). In B. cereus spore detection, both antibodies showed the same sensitivity (106 spores/ml), but the single-chain antibody generated a weaker signal than the native monoclonal antibody detection system (Fig. 6).

TABLE 2.

Antigen specificities of monoclonal and single-chain antibodies with bacterial spores and vegetative cells

Spore or cell Native monoclonal antibody Single-chain antibody
B. cereus T spores +++a ++
B. subtilis subsp. globigii spores ++ ++
B. subtilis A spores − +
B. megaterium spores + −
B. stearothermophilus spores − −
C. perfringens spores − +
B. cereus T vegetative cells − −
Negative controlb − −
Open in a new tab
a

+++, strong reactivity; −, no reactivity. 

b

No spores or cells added. 

FIG. 6.

FIG. 6

Open in a new tab

Sensitivity test for B. cereus spore detection. (A) Native monoclonal antibody; (B) single-chain anti-B. cereus T antibody (shown in triplicate). Rows: 1, 107 spores/well; 2, 106 spores/well; 3, 105 spores/well; 4, negative control (no spore added). One hundred microliters of spore suspension per well was added in each case.

DISCUSSION

For synthesis of a single-chain antibody having the same primary structure as the antigen binding domains of its parent monoclonal antibody, use of the mRNA of the hybridoma cells as the gene source is straightforward. Two different approaches have been used for this RT-PCR cloning; both of them take advantage of the fact that mammalian heavy- and light-chain immunoglobulins contain four conserved framework regions (FRs) adjacent to the three complementarity-determining regions. One approach uses FR1 and FR4 as the primer annealing area (32). These internal PCR primers anneal to the variable-region sequences (Fig. 1). In this case, the primers used in PCR need not match the annealing region exactly; thus, PCR mismatches resulting in minor changes of the amino acid sequence at both ends can occur (33). Occasionally the internal primers fail to clone mouse immunoglobulin variable-region genes from certain gene families due to the dissimilar sequences from the cloning primers (32). Nevertheless, this approach has been used successfully to clone the chosen target antibody genes (11, 32, 44).

In the second approach, an external primer set is used for gene cloning (19). The constant region and leader sequences, which flank the variable region, are used for the primer hybridization areas. This primer set containing different groups of primers can be used to clone the variable-region genes of unknown sequence efficiently and avoids any base changes that may be caused by the mispairing of PCR primers with the framework regions.

In this study, the external PCR primer set was used. Thus, the 3′-primer that annealed to the mouse constant region near the junction of the variable-constant region was used for both cDNA synthesis and PCR amplification. The 5′-primers hybridized with the leader sequence upstream of FR1. Although 14 individual PCR tubes were needed for different primer groups, this approach allowed the full length of the variable-region genes to be cloned.

The antibody variable-region domains contain two intramolecular disulfide bonds. Formation of correct disulfide bonds is critical in maintaining normal protein conformation for antigen binding (17). In our original design, the pelB signal peptide sequence, which has been used successfully in other single-chain-antibody expression systems (22, 27), was added to facilitate the secretion of soluble single-chain antibody into the periplasmic space and formation of correct disulfide bonds. This design should simplify fusion protein purification and avoid the formation of cytoplasmic inclusion bodies. However, SDS-PAGE and Western blotting failed to detect the soluble strep tag-conjugated single-chain antibody in the osmotic shock fraction. Most of the fusion protein was present as an insoluble form. The formation of periplasmic inclusion bodies (13) could explain this observation. Basic amino acids, particularly arginine, positioned downstream from the signal peptide can inhibit protein translocation into the periplasm, but the further away the basic amino acid is from the N terminus, the weaker is the blocking effect (4). According to the DNA sequencing data, this single-chain antibody does not contain any arginine in the first 30 amino acids of the N-terminal end; it contains only lysine and histidine residues in its 19th and 27th positions, respectively. Thus, a basic amino acid blocking effect should not be a critical factor for inhibition of protein translocation in this expression system. Some hydrophobic domains in membrane proteins can also inhibit protein translocation (45). However, according to a protein hydrophobicity analysis developed by Kyte et al. (25) and Klein et al. (23), the signal peptide was the only hydrophobic domain in this fusion protein. The N-terminal sequencing verified that the fusion protein in the final solubilized cellular fraction was correctly processed. The active fusion protein was recovered by solubilization with 6 M guanidine-HCl, followed by dialysis against phosphate buffer. It did not require reduction of the protein and regeneration of the disulfide bonds. Therefore, the correctly folded fusion protein apparently formed yet aggregated, forming a periplasmic inclusion body. The high fusion protein expression level (approximately 20% of the total protein was single-chain antibody) could account for aggregation of a newly synthesized protein.

Functional tests revealed that the specificity of this recombinant antibody and that of its parent native monoclonal antibody were similar; however, the signal generated by the strep tag-fusion antibody system was weaker than that of the native monoclonal antibody. Several reasons could account for this observation. Steric hindrance from the variable-region domains could interfere with the binding between strep tag and streptavidin-conjugated enzyme. A decreased affinity of the single-chain antibody for its antigen is also possible. The single-chain antibody uses a peptide linker to flexibly connect its two domains, thus preventing dissociation of the two variable-region domains in a physiological environment. However, the linker peptide may either distort or not fully stabilize the precise conformation of the antigen-binding domain (16, 36). It has been found that some single-chain antibodies have a 5- to 10-fold-lower antigen binding affinity compared with that of the parent monoclonal antibodies (16, 36, 44). Furthermore, Huston et al. (16) observed that the antidigoxin single-chain antibody exhibited a slight shift in antigen specificity. If this single-chain antibody had a reduced affinity, it would show a weaker signal than the native monoclonal antibody in the dot blot immunoassay. This possible conformational flexibility could also explain the unexpected cross-reaction with other spores.

The anti-B. cereus single-chain antibody expressed by E. coli exhibited potential use in spore detection, although some functional imperfections existed. Recently, new approaches to improve recombinant antibody fragments have been developed. Introducing an optional interchain disulfide bond (14, 36) can tightly link the two variable-region domains. This design enhanced the affinity and stability of some single-chain antibodies. Gene shuffling and phage display technologies (11, 29) have also been demonstrated to improve the characteristics of single-chain antibodies and obviate the need for animal immunization or hybridoma operations. These approaches could be examined to enhance the function of this anti-B. cereus spore single-chain antibody and develop new single-chain antibodies against other pathogens.

ACKNOWLEDGMENTS

This study was supported by USDA National Research Initiative in Food Safety through competitive grant no. 93-03930 and by Dairy Management, Inc., through the Southeast Dairy Foods Research Center.

Footnotes

†

Paper no. FSR97-42 of the Journal Series of the Department of Food Science, North Carolina State University, Raleigh.

REFERENCES

  • 1.Bassam B J, Caetano-Anolles G, Gresshoff P M. Fast and sensitive silver staining of DNA in polyacrylamide gels. Anal Biochem. 1991;196:80–83. doi: 10.1016/0003-2697(91)90120-i. [DOI] [PubMed] [Google Scholar]
  • 2.Berry M J, Davies J, Smith C G, Smith I. Immobilization of Fv antibody fragments on porous silica and their utility in affinity chromatography. J Chromatogr. 1991;587:161–169. doi: 10.1016/0021-9673(91)85152-6. [DOI] [PubMed] [Google Scholar]
  • 3.Bird R E, Hardman K D, Jacobson J W, Johnson S, Kaufman B M, Lee S-M, Lee T, Pope S H, Riordan G S, Whitlow M. Single-chain antigen-binding proteins. Science. 1988;242:423–426. doi: 10.1126/science.3140379. [DOI] [PubMed] [Google Scholar]
  • 4.Boyd D, Beckwith J. The role of charged amino acids in the localization of secreted and membrane proteins. Cell. 1990;62:1031–1033. doi: 10.1016/0092-8674(90)90378-r. [DOI] [PubMed] [Google Scholar]
  • 5.Bradford M M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72:248–254. doi: 10.1016/0003-2697(76)90527-3. [DOI] [PubMed] [Google Scholar]
  • 6.Canaan-Haden L, Ayala M, Fernandez-de-Cossio M E, Pedroso I, Rodes L, Cavilondo J V. Purification and application of a single-chain Fv antibody fragments specific to hepatitis B virus surface antigen. BioTechniques. 1995;19:606–613. [PubMed] [Google Scholar]
  • 7.Carrier A, Ducancel F, Settiawan N B, Cattolico L, Maillere B, Leonetti M, Drevet P, Menez A, Boulain J. Recombinant antibody-alkaline phosphatase conjugates for diagnosis of human IgGs: application to anti-HBsAg detection. J Immunol Methods. 1995;181:177–186. doi: 10.1016/0022-1759(94)00344-v. [DOI] [PubMed] [Google Scholar]
  • 8.Carroll W L, Mendel E, Levy S. Hybridoma fusion cell lines contain an aberrant kappa transcript. Mol Immunol. 1988;25:991–995. doi: 10.1016/0161-5890(88)90005-3. [DOI] [PubMed] [Google Scholar]
  • 9.Christiansson A. The toxicology of Bacillus cereus. Bull Int Dairy Fed. 1992;275:30–35. [Google Scholar]
  • 10.Chung C T, Niemela S L, Miller R H. One-step preparation of competent Escherichia coli: transformation and storage of bacterial cells in the same solution. Proc Natl Acad Sci USA. 1989;86:2172–2175. doi: 10.1073/pnas.86.7.2172. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Clackson T, Hoogenboom H R, Griffiths A D, Winter G. Making antibody fragments using phage display libraries. Nature. 1991;352:624–628. doi: 10.1038/352624a0. [DOI] [PubMed] [Google Scholar]
  • 12.Crielly E M, Logan N A, Anderton A. Studies on the Bacillus flora of milk and milk products. J Appl Bacteriol. 1994;77:256–263. doi: 10.1111/j.1365-2672.1994.tb03072.x. [DOI] [PubMed] [Google Scholar]
  • 13.Georgiou G, Telford J N, Shuler M L, Wilson D B. Localization of inclusion bodies in Escherichia coli overproducing β-lactamase or alkaline phosphatase. Appl Environ Microbiol. 1986;52:1157–1161. doi: 10.1128/aem.52.5.1157-1161.1986. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Glockshuber R, Malia M, Pfitzinger I, Pluckthun A. A comparison of strategies to stabilize immunoglobulin Fv-fragments. Biochemistry. 1990;29:1362–1367. doi: 10.1021/bi00458a002. [DOI] [PubMed] [Google Scholar]
  • 15.Gottlieb P D. Immunoglobulin genes. Mol Immunol. 1980;17:1423–1435. doi: 10.1016/0161-5890(80)90012-7. [DOI] [PubMed] [Google Scholar]
  • 16.Huston J S, Levinson D, Mudgett-Hunter M, Tai M-S, Novotny J, Margolies M N, Ridge R J, Bruccoleri R E, Haber E, Crea R, Oppermann H. Protein engineering of antibody binding sites: recovery of specific activity in an anti-digoxin single-chain Fv analogue produced in Escherichia coli. Proc Natl Acad Sci USA. 1988;85:5879–5883. doi: 10.1073/pnas.85.16.5879. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Huston J S, Mudgett-Hunter M, Tai M-S, McCartney J, Warren F, Haber E, Oppermann H. Protein engineering of single-chain Fv analogs and fusion proteins. Methods Enzymol. 1991;203:46–88. doi: 10.1016/0076-6879(91)03005-2. [DOI] [PubMed] [Google Scholar]
  • 18.Johnson K M, Nelson C L, Busta F F. Germination and heat resistance of Bacillus cereus spores from strains associated with diarrheal and emetic food-borne illnesses. J Food Sci. 1982;47:1268–1271. [Google Scholar]
  • 19.Jones S T, Bendig M M. Rapid PCR-cloning of full-length mouse immunoglobulin variable regions. Bio/Technology. 1991;9:88–89. doi: 10.1038/nbt0191-88. [DOI] [PubMed] [Google Scholar]
  • 20.Kearney J F, Radbruch A, Liesegang B, Rajewsky K. A new mouse myeloma cell line that has lost immunoglobulin expression but permits the construction of antibody-secreting hybrid cell lines. J Immunol. 1979;123:1548–1550. [PubMed] [Google Scholar]
  • 21.Keen N T, Tamaki S. Structure of two pectate lyase genes from Erwinia chrysanthemi EC16 and their high level expression in Escherichia coli. J Bacteriol. 1986;168:595–606. doi: 10.1128/jb.168.2.595-606.1986. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Kipriyanov S M, Moldenhauer G, Little M. High level production of soluble single chain antibodies in small-scale Escherichia coli cultures. J Immunol Methods. 1997;200:69–77. doi: 10.1016/s0022-1759(96)00188-3. [DOI] [PubMed] [Google Scholar]
  • 23.Klein P, Kanehisa M, DeLisi C. The detection and classification of membrane-spanning proteins. Biochim Biophys Acta. 1985;815:468–476. doi: 10.1016/0005-2736(85)90375-x. [DOI] [PubMed] [Google Scholar]
  • 24.Kretz K, Callen W, Hedden V. Cycle sequencing. In: Dieffenbach C W, Dveksler G S, editors. PCR primer: a laboratory manual. Plainview, N.Y: Cold Spring Harbor Laboratory Press; 1995. pp. 527–536. [Google Scholar]
  • 25.Kyte J, Doolittle R F. A simple method for displaying the hydropathic character of a protein. J Mol Biol. 1982;157:105–132. doi: 10.1016/0022-2836(82)90515-0. [DOI] [PubMed] [Google Scholar]
  • 26.Lee H A, Morgan M R A. Food immunoassays: applications of polyclonal, monoclonal and recombinant antibodies. Trends Food Sci Technol. 1993;4:129–134. [Google Scholar]
  • 27.Malby R L, Caldwell J B, Gruen L C, Harley V R, Ivancic N, Kortt A A, Lilley G G, Power B E, Webster R G, Colman P M, Hudson P J. Recombinant antineuraminidase single chain antibody: expression, characterization, and crystallization in complex with antigen. Proteins. 1993;16:57–63. doi: 10.1002/prot.340160107. [DOI] [PubMed] [Google Scholar]
  • 28.Maloy S R. Experimental techniques in bacterial genetics. Boston, Mass: Jones and Bartlett; 1990. [Google Scholar]
  • 29.Marks J D, Griffiths A D, Malmqvist M, Clackson T P, Bye J M, Winter G. By-passing immunization: building high affinity human antibodies by chain shuffling. Bio/Technology. 1992;10:779–783. doi: 10.1038/nbt0792-779. [DOI] [PubMed] [Google Scholar]
  • 30.Molloy P, Brydon L, Porter A J, Harris W J. Separation and concentration of bacteria with immobilized antibody fragments. J Appl Bacteriol. 1995;78:359–365. doi: 10.1111/j.1365-2672.1995.tb03418.x. [DOI] [PubMed] [Google Scholar]
  • 31.Neu H C, Heppel L A. The release of enzymes from Escherichia coli by osmostic shock and during the formation of spheroplasts. J Biol Chem. 1965;240:3685–3692. [PubMed] [Google Scholar]
  • 32.Orlandi R, Gussow D H, Jones P T, Winter G. Cloning immunoglobulin variable domains for expression by the polymerase chain reaction. Proc Natl Acad Sci USA. 1989;86:3833–3837. doi: 10.1073/pnas.86.10.3833. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Owens R J, Young R J. The genetic engineering of monoclonal antibodies. J Immunol Methods. 1994;168:149–165. doi: 10.1016/0022-1759(94)90051-5. [DOI] [PubMed] [Google Scholar]
  • 34.Phillips T M. Analytical techniques in immunochemistry. New York, N.Y: Marcel Dekker, Inc.; 1992. pp. 263–300. [Google Scholar]
  • 35.Quinlan J J, Foegeding P M. Monoclonal antibodies for use in detection of Bacillus and Clostridium spores. Appl Environ Microbiol. 1997;63:482–487. doi: 10.1128/aem.63.2.482-487.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Reiter Y, Brinkmann U, Lee B, Pastan I. Engineering antibody Fv fragments for cancer detection and therapy: disulfide-stabilized Fv fragments. Nat Biotechnol. 1996;14:1239–1245. doi: 10.1038/nbt1096-1239. [DOI] [PubMed] [Google Scholar]
  • 37.Ross G W, O’Callaghan C H. β-Lactamase assays. Methods Enzymol. 1975;43:69–85. doi: 10.1016/0076-6879(75)43081-6. [DOI] [PubMed] [Google Scholar]
  • 38.Sambrook J, Fritsch E F, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. Plainview, N.Y: Cold Spring Harbor Laboratory Press; 1989. [Google Scholar]
  • 39.Schmidt T G M, Skerra A. The random peptide library-assisted engineering of a C-terminal affinity peptide, useful for the detection and purification of a functional Ig Fv fragment. Prot Eng. 1993;6:109–122. doi: 10.1093/protein/6.1.109. [DOI] [PubMed] [Google Scholar]
  • 40.Schmidt T G M, Skerra A. One-step affinity purification of bacterially produced proteins by means of the “strep tag” and immobilized recombinant core streptavidin. J Chromatogr Ser A. 1994;676:337–345. doi: 10.1016/0021-9673(94)80434-6. [DOI] [PubMed] [Google Scholar]
  • 41.Skerra A, Pluckthun A. Assembly of a functional immunoglobulin Fv fragment in Escherichia coli. Science. 1988;240:1038–1041. doi: 10.1126/science.3285470. [DOI] [PubMed] [Google Scholar]
  • 42.Studier F W, Rosenberg A H, Dunn J J, Dubendorff J W. Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol. 1990;185:60–89. doi: 10.1016/0076-6879(90)85008-c. [DOI] [PubMed] [Google Scholar]
  • 43.Towbin H, Staehelin T, Gordon J. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc Natl Acad Sci USA. 1979;76:4350–4354. doi: 10.1073/pnas.76.9.4350. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Wels W, Harwerth I, Zwickl M, Hardman N, Groner B, Hynes N E. Construction, bacterial expression and characterization of a bifunctional single-chain antibody-phosphatase fusion protein targeted to human erbb-2 receptor. Bio/Technology. 1992;10:1128–1132. doi: 10.1038/nbt1092-1128. [DOI] [PubMed] [Google Scholar]
  • 45.Yamane K, Mizushima S. Introduction of basic amino acid residues after the signal peptide inhibits protein translocation across the cytoplasmic membrane of Escherichia coli. J Biol Chem. 1988;263:19690–19696. [PubMed] [Google Scholar]

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES