Skip to main content
NCBI home page
Tissue Engineering and Regenerative Medicine logoLink to Tissue Engineering and Regenerative Medicine
. 2023 Aug 23;20(7):1133–1143. doi: 10.1007/s13770-023-00568-3

Enhancing Viability of Human Embryonic Stem Cells during Cryopreservation via RGD-REP-Mediated Activation of FAK/AKT/FoxO3a Signaling Pathway

Jeong Hee Kim 1, Jeong In Choi 1, Young Hyun Che 1, Su Haeng Sung 2, Hojae Lee 3, Sun Lee 2, Jae-Hoon Park 2, Yun-Il Lee 4,5, Young-Sam Lee 6, Won Bae Jeon 4, Yong Jun Kim 1,2,7,✉
PMCID: PMC10646010  PMID: 37610706

Abstract

Background

Cryopreservation is a crucial method for long-term storage and stable allocation of human pluripotent stem cells (hPSCs), which are increasingly being used in various applications. However, preserving hPSCs in cryogenic conditions is challenging due to reduced recovery rates.

Methods

To address this issue, the Arginine-Glycine-Aspartate (RGD) motif was incorporated into a recombinant elastin-like peptide (REP). Human embryonic stem cells (hESCs) were treated with REP containing RGD motif (RGD-REP) during suspension and cryopreservation, and the survival rate was analyzed. The underlying mechanisms were also investigated.

Results

The addition of RGD-REP to the cryopreservation solution improved cell survival and pluripotency marker expression. The improvement was confirmed to be due to the activation of the FAK-AKT cascade by RGD-REP binding to hESC surface interin protein, and consequent inhibition of FoxO3a. The inactivation of FoxO3a reduced the expression of apoptosis-related genes, such as BIM, leading to increased survival of PSCs in a suspension state.

Conclusion

RGD-REP, as a ligand for integrin protein, improves the survival and maintenance of hPSCs during cryopreservation by activating survival signals via the RGD motif. These results have potential implications for improving the efficiency of stem cell usage in both research and therapeutic applications.

Keywords: Human embryonic stem cell, In vitro culture, Extracellular matrix, RGD motif, Cryopreservation

Introduction

Efficient conditions for stem cell management are needed as the application of human pluripotent stem cells (hPSCs) expands [1]. Cryopreservation and recovery processes are crucial for long-term storage and stable cell source allocation. Despite numerous studies exploring biomaterials for preserving stem cells in cryogenic conditions [2], the challenge remains to protect them from the harsh preservation environment that can lead to reduced recovery rates [3].

The impact of extracellular matrix (ECM) on hPSC maintenance has been studied for its ability to support growth signals and prevent spontaneous differentiation. Analysis of embryonic stem cell (ESC) environments in vivo has revealed the biological roles and mechanisms of ECMs like collagen, fibronectin, laminin, and vitronectin, which are often used to replace feeder cells or artificial matrices in maintaining hPSCs in vitro [4–6]. Artificial ECMs that aid hPSC survival have also been found and applied in vitro, replacing undefined ECMs like Matrigel that pose a risk of uncontrolled signal stimulation [7]. ECM proteins used in hPSC culture have a common Arginine-Glycine-Aspartate (RGD) motif that binds to integrins expressed by hPSCs [8–11]. The RGD motif not only physiologically interacts with integrins but also activates signals that shape the stem cell niche through proteolytic process-induced structural modifications that promote biochemical or mechanical stimulation [12]. These ECM-activated signals in vitro reduce cellular stress and enhance stem cell adhesion, migration, proliferation, and differentiation [7, 13]. Although adding ECMs with the RGD motif was expected to increase stem cell viability during cryopreservation by inhibiting anoikis [14], it cannot be used as a cytoprotective additive as it may stimulate unnecessary signal transduction mechanisms beyond stemness maintenance [7].

We present an effective method for cytoprotection during cryopreservation using a defined substance that increases hPSC viability without inducing unnecessary signaling stimulation. The addition of a recombinant elastin-like peptide (REP) with an RGD motif (RGD-REP) activated the FAK-PI3K-AKT axis and improved hPSC viability during recovery from cryopreservation. The hPSCs that survived effectively with REP retained their stemness from the beginning of recovery, reducing the time needed to obtain a sufficient quantity of competent stem cells from cryopreserved stocks.

Materials and methods

Human embryonic stem cell culture and RGD-REP treatment

WA09, a human ESC line purchased from WiCell (Wisconsin, USA). WA09 and previously reported WA09-based OCT4 reporter hESC line (OCT4::eGFP) [15] were cultured by everyday feeding of Essential 8 medium (Thermo Fisher, Waltham, MA, USA) on the iMatrix-511 coating material (Matrixome, Osaka, Japan). Stem cells were passaged once a week using Versene solution (Thermo Fisher). To cryopreserve hESCs, cells were treated with Accutase (Sigma Aldrich, St. Louis, MO, USA) for 10 min and pipetted vigorously to obtain single cells. The resulting single cells were resuspended using a stock solution composed of 90% fetal bovine serum (Welgene Inc., Gyeongsan, Korea) and 10% dimethyl sulfoxide (Sigma Aldrich), regardless of the presence of RGD-REP [16]. Stock vials were stored at −70 °C for seven days and in a liquid nitrogen tank for an additional seven days. After 14 days of cryopreservation, hESC stock vials were rapidly thawed and exposed to normal hESC culture conditions. Experiments were carried out under the condition of monitoring for mycoplasma contamination at bi-weekly intervals using the MycoAlert™ Mycoplasma Detection Kit (Lonza, Basel, Swiss) between passages 33 and 45. All experiments using hESCs were conducted in accordance with the regulation KHSIRB-20–489 permitted by Kyung Hee University institutional review board (IRB).

Preparation of RGD-REP

Cloning, expression and purification of RGD-REP performed according to the methods previously reported [17]. Briefly, The REP gene was generated by inserting a reaction product into pUC19 plasmid, which was digested with EcoRI and HindIII enzymes. The REP gene was then transferred into pET25 (+) vector and expressed in BLR (DE3) E. coli strain. The purified REP protein was determined to have a molecular weight using SDS-PAGE (Fig. 2A).

Fig. 2.

Fig. 2

Open in a new tab

Verification of the effect of RGD-REP on hESC viability during suspension culture. A SDS-PAGE of RGD-REP produced in E. coli. The arrow indicates the protein band for RGD-REP. M = size marker, P = cell pellet. B Confirmation of precipitation of RGD-REP peptides according to concentrations at 25 °C and 37 °C. The red line indicates RGD-REP distribution. C Distribution and separation of hESCs in 50 uM RGD-REP solution. Red line is culture medium containing hESCs and blue line is precipitated RGD-REP. D Fluid status of RGD-REP-added culture medium in a rotating tube at 37 °C. E Representative FACS plot of 7-AAD negative hESCs after 24 h suspension culture with the indicated concentration of RGD-REP. Red values represent 7-AAD negative ratio, indicating the survival rate. F Bar graph quantifying FACS data in (E). Data expressed as mean ± SD (n = 3, biological repeat) and p-values calculated by two-way ANOVA. G Representative FACS plot of OCT4::eGFP expressing hESCs after 24 h suspension culture with the indicated concentration of RGD-REP. Red values represent ratio of OCT4::eGFP positive cells. H Bar graph quantifying FACS data in (G). Data expressed as mean ± SD (n = 3, biological repeat) and p-values calculated by two-way ANOVA. I Representative images for colony morphology of replating hESCs and expression of OCT4 and NANOG. Scale bars = 50 μm. J Post-replating proliferation curve of hESCs expressing OCT4 after suspension culture with RGD-REP. Data expressed as mean ± SD (n = 3, biological repeat) and p-values calculated by two-way ANOVA. ****P < 0.0001, ns = non significance

Flow cytometry (FACS) analysis

To perform FACS analysis, hESCs were thawed from frozen stocks or harvested using Accutase. Cells were filtered through a mesh-cap into round-bottom FACS tubes, and resuspended with PBS-based FACS buffer containing 1% of fetal bovine serum and 1 ug/ml of DNase I (Sigma Aldrich). For FACS-purposed immunostaining, collected cells (1 × 106) were incubated in FACS buffer containing 1 ug/ml of each antibody (Table 3) for 1 h at 4 °C. To measure the ratio of cell death, 7-Aminoactinomycin D (7-AAD) (Thermo Fisher) was added to the FACS buffer prior to FACS analysis. Cells were analyzed with an FC500 (Beckman coulter, INC., Brea, CA, USA) or an SH800 (SONY, Tokyo, Japan). FACS data was analyzed using FlowJo v10 (FlowJo, LLC).

Quantitative real time-polymerase chain reaction (qRT-PCR)

Total RNA was extracted from harvested cell pellets using TRIzol Reagent (Thermo Fisher), and 1 µg of total RNA was reverse transcribed using the High Capacity cDNA Reverse Transcription Kit with random sequenced primer (Thermo Fisher). The qRT-PCR mixtures were prepared with SYBR Green PCR Master Mix (Kapa Biosystem, Wilmington, MA, USA), and the reactions were performed using the StepOne Plus PCR machine (Applied Biosystems, Foster City, CA, USA). Transcription levels of target genes were assessed by normalizing to 18S RNA expression (Table 1).

Table 1.

List of primers and antibodies

qPCR primers
Gene Forward Reverse
SOX1 GAGTGGAAGGTCATGTCCGAGG CCTTCTTGAGCAGCGTCTTGGT
GATA4 GCGGTGCTTCCAGCAACTCCA GACATCGCACTGACTGAGAACG
Brachyury CCTTCAGCAAAGTCAAGCTCACC TGAACTGGGTCTCAGGGAAGCA
18S rRNA GGCCCTGTAATTGGAATGAG GGCCCTGTAATTGGAATGAG
Antibodies
Target Company Application
ITGAV BioLegend, 327,907 FACS
ITGA1 BioLegend, 328,307 FACS
ITGA4 BioLegend, 103,705 FACS
ITGA5 Thermo Fisher, A15400 FACS
ITGA6 BioLegend, 313,605 FACS
ITGB1 Thermo Fisher, CD2901 FACS
ITGB3 BD bioscience, 561,912 FACS
ITGB4 BioLegend, 123,609 FACS
OCT4 Santa Cruz, sc-3444 Immunofluorescence
NANOG Cell signaling, #3580 Immunofluorescence
Phospho-FAK Cell signaling, #8556 Western blotting
FAK Cell signaling, #3285 Western blotting
Phospho-ERK Cell signaling, #4376 Western blotting
ERK Cell signaling, #4695 Western blotting
Phospho-AKT Cell signaling, #13,038 Western blotting
AKT Cell signaling, #4685 Western blotting
GAPDH Santa Cruz, sc-47724 Western blotting
Phospho-FoxO3a Cell signaling, #9466 Western blotting
FoxO3a Cell signaling, #12,829 Western blotting
BIM Cell signaling, #2933 Western blotting
7-AAD Invitrogen, A1310 FACS
Open in a new tab

Western blotting

Cells were harvested using 0.5% Trypsin solution (Welgene, Inc.), and total protein was extracted using RIPA buffer (Thermo Fisher) followed by denaturation at the heat block for 5 min. Protein samples were loaded and separated at the 10% sodium dodecyl sulfate–polyacrylamide gels, and transferred to PVDF membrane (Millipore, Burlington, MA, USA) using a semi-dry transfer kit (ATTA, Tokyo, Japan). Membranes were incubated with primary antibodies (Table 3) in 5% skim milk or 5% bovine serum albumin (BSA) containing TBS-T for 1 h at 4 °C, and further incubated with appropriate secondary antibodies for 1 h at room temperature. Protein bands were detected by manually performed X-ray film development (GE Healthcare, Piscataway, NY, USA), and the intensity of bands was measured using the Image J image processing package (Image J software (Rasband, W.S., ImageJ, U. S. National Institutes of Health, ME, USA, http://imagej.nih.gov/ij/, 1997–2014).

Immunofluorescence staining

Live cells were fixed with 4% paraformaldehyde for 15 min. Then permeabilized with PBS-based solution containing 0.1% Triton X-100 and 0.5% BSA. Primary antibodies (Table 3) were applied after blocking with 0.5% BSA solution and incubated for 12 h at 4 °C. Appropriate secondary antibodies were applied for 1 h at room temperature. Nuclei were stained with DAPI for 15 min, and stained cells were visualized using fluorescence microscope (Olimpus IX-71 or Nikon Eclipse E800).

Statistical analysis

All statistical analyses were performed by Prism 9 (GraphPad). The values were the results of at least three independent experiments, with multiple replicates of each, and reported as the mean ± standard deviation (SD). Differences between samples were analyzed for significance using the paied t-test, unpaired t-test, one-way ANOVA, or two-way ANOVA. The transcriptome results for hESCs and fibroblasts were re-analyzed based on the raw values shared in the GEO public database under GSE148158 and GSE159410.

Results

The hESCs expressed an integrin protein family

To determine the presence of integrins in human embryonic stem cells (hESCs) that bind to the RGD motif [8–11, 18, 19], we analyzed previously reported RNA sequencing results of hESCs (H1 and H9) and fibroblasts (CRL and BJ) [20]. Although most integrin subunits were expressed at lower levels in hESCs compared to fibroblasts, various integrins such as ITGA1, ITGA2B, ITGA3, ITGA5, ITGA6, ITGA7, ITGA9, ITGB1, ITGB2, ITGB4, ITGB5, and ITGB8 were expressed in significant amounts in hESCs (Fig. 1A). Further validation showed that hESCs express integrin alpha family members ITGAV, ITGA1, ITGA4, ITGA5, and ITGA6, as well as integrin beta family members ITGB1, ITGB3, and ITGB4 through FACS analysis using specific antibodies (Fig. 1B) [21]. These findings demonstrate that hESCs possess receptor components capable of binding to the RGD motif.

Fig. 1.

Fig. 1

Open in a new tab

Verifying integrin expression in hESCs for RGD motif binding. A Heatmap of the analysis of mRNA transcription levels of cell type markers and integrin family in human embryonic stem cells and fibroblasts. B Validation of integrin protein expression in hESC using FACS

RGD-REP enhanced HESC survival in the suspension state

To verify the prevention of anoikis and consequent increase in cell viability of hESCs by the integrin binding properties of RGD-REP, conditions for RGD-REP treatment were established during hESC suspension culture. Since RGD-REP forms reversible aggregates in response to thermo-regulation, we tested concentrations capable of continuous reaction with hESCs in suspension without sinking at 37 °C, which is a temperature for general cell culture. RGD-REP purified from E. coli (Fig. 2A) was diluted at two temperatures, 25 °C and 37 °C, for different concentrations. As the RGD-REP concentration in PBS increased, non-cohesive precipitation was observed at 25 °C At 37 °C, the movement of suspension cells in the flow of the culture medium was found to be suppressed when the RGD-REP concentration reached 10 µM or higher (Fig. 2B). While RGD-REP precipitates with cells even at 37 °C at high concentrations (Fig. 2C), no precipitation is formed by applying rotation during the suspension culture of hESC at concentrations below 10 uM (Fig. 2D). After 24 h of suspension culture in a medium containing RGD-REP, hESCs were stained with 7-AAD to determine the ratio of apoptotic cells. It was confirmed that the addition of 1uM of RGD-REP to the culture medium resulted in increased cell survival (16.4%) compared to hESCs cultured without RGD-REP (7.37%) (Figs. 2E, F). When hESCs detach from the ECM and enter a suspension state, they lose pluripotency and undergo differentiation or apoptosis. To investigate whether RGD-REP maintains pluripotency of hESCs in suspension, we cultured the OCT::eGFP reporter hESC line [15] in a suspension state with the addition of RGD-REP. While approximately 85% of hESCs maintained in a typical culture environment attached to the ECM expressed OCT4::eGFP, only around 3% of surviving cells in suspension culture expressed OCT4::eGFP. However, upon the addition of 1uM RGD-REP, approximately 83% of the surviving cells in the suspension culture expressed OCT4::eGFP (Figs. 2G, H). Cells that continually expressed OCT4 in a suspension culture containing 1 µM RGD-REP were isolated using a FACS-sorter and attached to an ECM-coated plate for further growth. These cells retained hESC characteristics, such as colony formation and expression of pluripotency markers like OCT4 and NANOG (Fig. 2I), and showed a similar proliferation rate to hESCs not exposed to suspension culture (Fig. 2J). These results suggest that the addition of RGD-REP in the optimal range to the culture medium improves the survival rate in the suspension state of hESCs.

RGD-REP improved hESC survival rate during cryopreservation

The impact of RGD-REP on enhancing hESC survival in the suspension state during cryopreservation was evaluated. OCT4::eGFP reporter hESCs were cryopreserved using a solution containing 1 µM RGD-REP and were thawed and re-cultivated after 7 days (Fig. 3A). The FACS results obtained immediately after thawing showed that the expression rate of OCT4 in frozen cells with added RGD-REP was similar to that of the control (Fig. 3B). Immediately after thawing, the rate of cell death as indicated by 7-AAD was lower in the RGD-REP treated group compared to the control (Fig. 3C), and the number of cells increased during subculture after 7 days of cultivation when compared to the control group (Fig. 3D). The results of the post-thaw subculture showed that the number of surviving hESCs that were frozen with the addition of RGD-REP was consistently higher even after 14 days compared to the control, in agreement with the results obtained immediately after thawing (Fig. 3E). The hESCs with increased survival rates in the frozen state due to the addition of RGD-REP exhibited a colony formation ability similar to that of normal hESCs that were not exposed to RGD-REP (Fig. 3F), and expressed appropriate differentiation markers, such as SOX1, GATA4, or Brachyury, during the initial differentiation into trilineage differentiation (Fig. 3G).

Fig. 3.

Fig. 3

Open in a new tab

Enhancement of hESC survival during cryopreservation by RGD-REP peptide. A A schematic diagram of the concept of adding RGD-REP during hESC cryopreservation. B Representative FACS plot for measuring the ratio of cells expressing OCT4 immediately after thawing of OCT4::eGFP reporter hESC, which have been cryopreserved by adding RGD-REP. C Ratio of dead cells detected by 7-AAD immediately after thawing of OCT4::eGFP reporter hESCs cryopreserved by adding RGD-REP. Data expressed as mean ± SD (n = 9, biological repeat) and p-values calculated by paired t-test. D Number of cells after 7 days incubation of OCT4 expressing cells isolated from OCT4::eGFP reporter hESCs after cryopreservation with adding RGD-REP. Data expressed as mean ± SD (n = 9, biological repeat) and p-values calculated by paired t-test. E Post-replating proliferation curve of hESCs expressing OCT4 after cryopreservation with RGD-REP. Data expressed as mean ± SD (n = 3, biological repeat) and p-values calculated by two-way ANOVA. F Represent images colony area according to colony formation and proliferation after passaging of hESCs frozen in the presence of RGD-REP. Scale bars = 1 mm. G Quantitative RT-PCR results to verify the expression of marker genes for ectoderm (SOX1), endoderm (GATA4), or mesoderm (Brachyury) on day 3 of trilineage differentiation of hESCs. Data expressed as mean ± SD (n = 9, biological repeat) and p-values calculated by paired t-test. ****P < 0.0001

The RGD-REP activated the integrin signaling cascade in cryopreserved hESCs

Confirmation of the activation of downstream pathway proteins was carried out to determine whether the RGD motif present in REP functions as a ligand for the integrin family expressed by hESCs. Immediately after thawing from cryopreservation, hESCs that had been frozen with RGD-REP showed increased phosphorylation of FAK compared to hESCs that had been frozen without RGD-REP (Figs. 4A, B). The phosphorylation of ERK, a downstream target of FAK activation via integrin stimulation, did not show significant differences between hESCs frozen with RGD-REP and those without it (Figs. 4A and C). After thawing, hESCs frozen with RGD-REP showed a level of AKT phosphorylation comparable to normally cultured hESCs, while hESCs frozen without RGD-REP did not show AKT phosphorylation (Figs. 4A, D).

Fig. 4.

Fig. 4

Open in a new tab

Investigating the role of RGD-REP in integrin signaling of cryopreserved hESCs. A Representative western blot images for validation of FAK, AKT, and ERK signaling activation of hESCs according to RGD-REP application. GAPDH was used as an internal control. B Quantitative analysis graph based on the intensity of the band for FAK and pFAK identified in (A). C Quantitative analysis graph based on the intensity of the band for ERK and pERK identified in (A). D Quantitative analysis graph based on the intensity of the band for AKT and pAKT identified in (A). Data expressed as mean ± SD and p-values calculated by one-way ANOVA. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001

The enhancement of hESC survival induced by RGD-REP is facilitated through the FAK-AKT-FoxO3a signaling cascade

Prior to cryopreservation with or without RGD-REP, inhibitors for AKT (MK-2206) or ERK (PD0325901) were applied to hESCs to inhibit AKT or ERK activities for 24 h (Fig. 5A). The results indicated that AKT inhibition, but not ERK inhibition, abrogated the RGD-REP-induced survival rate enhancement of hESCs after thawing, leading to a survival rate comparable to hESCs cryopreserved without RGD-REP addition (Fig. 5B). Inhibition of AKT activity, which abolished the enhancement of survival by RGD-REP, resulted in morphologically differentiated hESCs expressing SSEA1, a marker of loss of pluripotency in hESCs, even though AKT inhibitors were no longer present during the cultivation of thawed hESCs (Fig. 5C). Suppression of AKT activity induced by FAK resulted in a decrease in inhibitory phosphorylation of FoxO3a, which was elevated by the addition of RGD-REP, to a level lower than that of hESCs under normal culture conditions (Figs. 5D, E). The decrease in inhibitory phosphorylation of FoxO3a consequently led to an increase in the protein level of BIM, a downstream transcriptional target of active FoxO3a (Figs. 5D, F). Taken together, stimulation of RGD-REP to the integrins of hESCs activates the FAK-AKT signal cascade, promoting stem cell survival by preventing the activation of the apoptotic signaling pathway through the inhibition of FoxO3a activity (Fig. 5G).

Fig. 5.

Fig. 5

Open in a new tab

Impact of AKT and ERK inhibition on RGD-REP-induced hESC survival enhancement. A Representative western blot images for validation of ERK and AKT signaling activation of hESCs according to ERK inhibitor or AKT inhibitor on RGD-REP application. GAPDH was used as an internal control. B Cell survival rate based on 7-AAD negative population of RGD-REP-applied cryopreserved hESCs after ERK- or AKT-inhibition. Data expressed as mean ± SD (n = 6, biological repeat) and p-values calculated by one-way ANOVA. C Cell differentiation rate based on SSEA1 positive population of RGD-REP-applied cryopreserved hESCs with ERK- or AKT-inhibition, and their morphology. Data expressed as mean ± SD (n = 6, biological repeat) and p-values calculated by one-way ANOVA. Scale bars = 100 μm. D Representative western blot images for validation of FoxO3a signaling activation of hESCs according to ERK inhibitor or AKT inhibitor on RGD-REP application. BIM was detected as a downstream protein of FoxO3a, and GAPDH was used as an internal control. E Quantitative analysis graph based on the intensity of the band for FoxO3a and pFoxO3a identified in (D). Data expressed as mean ± SD (n = 3, biological repeat) and p-values calculated by one-way ANOVA. F Quantitative analysis graph based on the intensity of the band for BIM identified in (D). Data expressed as mean ± SD (n = 3, biological repeat) and p-values calculated by one-way ANOVA. G A schematic illustration of the underlying mechanism of the RGD-REP-induced improvement of hESC viability. *P < 0.05, ***P < 0.001, ****P < 0.0001, ns = non significance

Discussion

The cryopreservation and thawing of stem cells result in significant impacts on physical and biological processes, leading to metabolic and structural changes that cause cellular damage, cell death, and alterations in biological features [22]. To effectively preserve PSCs, efforts have been made to minimize damage from physicochemical stimuli and supplement nutritional components, thereby maintaining their biological homeostasis [23, 24].The aim of this study was to maintain the contact of PSCs with the ECM while they are in a suspension state, with a focus on activating survival signaling pathways such as AKT and ERK upon attachment to the ECM during normal culture [25]. To exclude potential biological stimulation originating from the structural properties of ECM proteins [26], only the RGD motif of ECM proteins was utilized. This motif was incorporated into an elastin structure, which does not exhibit any biological activity toward PSCs [27]. The results showed that the RGD-REP enhanced the survival of hESCs in suspension culture and cryopreservation (Figs. 2E and 3C). Adding RGD-REP to the cryopreservation solution improved cell survival and the expression of pluripotency markers (Figs. 2G and 3B). These findings suggest that RGD-REP enhances the survival rate of hESCs in a suspension state and during cryopreservation. The mechanism underlying this improvement was confirmed to be the activation of the FAK-AKT cascade (Figs. 4 and 5A) and the consequent inhibition of FoxO3a by RGD-REP binding to the surface integrin protein of hESCs (Figs. 5D, E). The inactivation of FoxO3a reduced the expression of genes involved in apoptosis, such as BIM (Figs. 5D, F), resulting in increased survival of PSCs in a suspension state.

The activation of AKT and ERK is triggered by the activation of FAK upon RGD binding to integrin as a ligand [28]. Our study discovered that RGD-induced AKT activation, not ERK, plays a crucial role in improving the survival of PSCs (Fig. 5A–C). AKT and ERK activation are essential survival signaling pathways in PSCs [29], while ERK activation also contributes to cell differentiation signals [29–31]. Indeed, our experimental results showed that suppression of AKT enhances ERK activation, encouraging spontaneous differentiation (Fig. 5A, C). Conversely, ERK inhibition promoted stem cell properties such colony formation by suppressing differentiation. However, to fully comprehend why RGD stimulation in our study preferentially activates AKT over ERK in PSCs, additional research is necessary. In addition, in order for RGD-REP to be utilized more broadly, its efficiency should be validated alongside the application of ECM components other than elastin [32] to various differentiated cells that may be used in cell therapy [33, 34].

In conclusion, this study demonstrated a successful approach to enhance the survival and maintenance of pluripotency in hPSCs during cryopreservation by stimulating their survival signals by using RGD-REP matrix. These results hold potential for improving the efficiency of stem cell usage in both research and therapeutic applications.

Acknowledgements

This Work in Kim lab was supported by the National Research Foundation of Korea (NRF-2022M3A9H1016308 and NRF-2022R1F1A1066611), the Korean Fund for Regenerative Medicine (2021M3E5E5096744), and the KIST Institutional Program (Project No. 2Z05790-19-037). Work in Jeon lab was supported by the National Research Foundation of Korea (NRF-2019M3A9H1103478). Illustrations were created using image sources from Biorender (www.biorender.com).

Author contribution

JHK: study design, performing experiments and data analysis; JIC, YHC, SHS and HL: performing experiments and data analysis; SL and JHP: data assembly and analysis; YIL and YSL: conception, study design, and data analysis; WBJ: conception and study design; YJK: conception, study design, data analysis, writing manuscript.

Declarations

Conflict of interest

Won Bae Jeon is the founder and CEO of Excellamol Inc., and has employment and financial relationships with Excellamol Inc., including patent inventions. All other authors have no financial conflicts of interests.

Ethical statement

All experiments using hESCs were conducted in accordance with the regulation KHSIRB-20–489 permitted by Kyung Hee University IRB.

Footnotes

Won Bae Jeon have Corresponding to REP material.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Liu G, David BT, Trawczynski M, Fessler RG. Advances in pluripotent stem cells: history, mechanisms, technologies, and applications. Stem Cell Rev Rep. 2020;16:3–32. doi: 10.1007/s12015-019-09935-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Tong Z, Solanki A, Hamilos A, Levy O, Wen K, Yin X, et al. Application of biomaterials to advance induced pluripotent stem cell research and therapy. EMBO J. 2015;34:987–1008. doi: 10.15252/embj.201490756. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Liu W, Chen G. Cryopreservation of human pluripotent stem cells in defined medium. Curr Protoc Stem Cell Biol. 2014;31:1–3. doi: 10.1002/9780470151808.sc01c17s31. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Sutherland AE, Calarco PG, Damsky CH. Expression and function of cell surface extracellular matrix receptors in mouse blastocyst attachment and outgrowth. J Cell Biol. 1988;106:1331–1348. doi: 10.1083/jcb.106.4.1331. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Douglas GC, Thirkill TL, Blankenship TN. Vitronectin receptors are expressed by macaque trophoblast cells and play a role in migration and adhesion to endothelium. Biochim Biophys Acta. 1999;1452:36–45. doi: 10.1016/S0167-4889(99)00109-3. [DOI] [PubMed] [Google Scholar]
  • 6.Lin G, Xu RH. Progresses and challenges in optimization of human pluripotent stem cell culture. Curr Stem Cell Res Ther. 2010;5:207–214. doi: 10.2174/157488810791824548. [DOI] [PubMed] [Google Scholar]
  • 7.Watt FM, Huck WT. Role of the extracellular matrix in regulating stem cell fate. Nat Rev Mol Cell Biol. 2013;14:467–473. doi: 10.1038/nrm3620. [DOI] [PubMed] [Google Scholar]
  • 8.Soininen R, Haka-Risku T, Prockop DJ, Tryggvason K. Complete primary structure of the alpha 1-chain of human basement membrane (type IV) collagen. FEBS Lett. 1987;225:188–194. doi: 10.1016/0014-5793(87)81155-9. [DOI] [PubMed] [Google Scholar]
  • 9.Ruoslahti E. Fibronectin and its receptors. Annu Rev Biochem. 1988;57:375–413. doi: 10.1146/annurev.bi.57.070188.002111. [DOI] [PubMed] [Google Scholar]
  • 10.Aumailley M, Gerl M, Sonnenberg A, Deutzmann R, Timpl R. Identification of the Arg-Gly-Asp sequence in laminin A chain as a latent cell-binding site being exposed in fragment P1. FEBS Lett. 1990;262:82–86. doi: 10.1016/0014-5793(90)80159-G. [DOI] [PubMed] [Google Scholar]
  • 11.Smith JW, Cheresh DA. The Arg-Gly-Asp binding domain of the vitronectin receptor. Photoaffinity cross-linking implicates amino acid residues 61–203 of the beta subunit. J Biol Chem. 1988;263:18726–31. doi: 10.1016/S0021-9258(18)37343-5. [DOI] [PubMed] [Google Scholar]
  • 12.Clause KC, Barker TH. Extracellular matrix signaling in morphogenesis and repair. Curr Opin Biotechnol. 2013;24:830–833. doi: 10.1016/j.copbio.2013.04.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Kim YJ, Lim H, Li Z, Oh Y, Kovlyagina I, Choi IY, et al. Generation of multipotent induced neural crest by direct reprogramming of human postnatal fibroblasts with a single transcription factor. Cell Stem Cell. 2014;15:497–506. doi: 10.1016/j.stem.2014.07.013. [DOI] [PubMed] [Google Scholar]
  • 14.Taddei ML, Giannoni E, Fiaschi T, Chiarugi P. Anoikis: an emerging hallmark in health and diseases. J Pathol. 2012;226:380–393. doi: 10.1002/path.3000. [DOI] [PubMed] [Google Scholar]
  • 15.Mukherjee-Clavin B, Mi R, Kern B, Choi IY, Lim H, Oh Y, et al. Comparison of three congruent patient-specific cell types for the modelling of a human genetic Schwann-cell disorder. Nat Biomed Eng. 2019;3:571–582. doi: 10.1038/s41551-019-0381-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Lee KM, Jung GS, Park JK, Choi SK, Jeon WB. Effects of Arg-Gly-Asp-modified elastin-like polypeptide on pseudoislet formation via up-regulation of cell adhesion molecules and extracellular matrix proteins. Acta Biomater. 2013;9:5600–5608. doi: 10.1016/j.actbio.2012.10.036. [DOI] [PubMed] [Google Scholar]
  • 17.Jeon WB, Park BH, Wei J, Park RW. Stimulation of fibroblasts and neuroblasts on a biomimetic extracellular matrix consisting of tandem repeats of the elastic VGVPG domain and RGD motif. J Biomed Mater Res A. 2011;97:152–157. doi: 10.1002/jbm.a.33041. [DOI] [PubMed] [Google Scholar]
  • 18.Haque MA, Nagaoka M, Hexig B, Akaike T. Artificial extracellular matrix for embryonic stem cell cultures: a new frontier of nanobiomaterials. Sci Technol Adv Mat. 2010;11:14106. doi: 10.1088/1468-6996/11/1/014106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Kapp TG, Rechenmacher F, Neubauer S, Maltsev OV, Cavalcanti-Adam EA, Zarka R, et al. A comprehensive evaluation of the activity and selectivity profile of ligands for RGD-binding integrins. Sci Rep. 2017;7:39805. doi: 10.1038/srep39805. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Quick HuK. Coordinated and authentic reprogramming of ribosome biogenesis during iPSC reprogramming. Cells. 2020;9:2484. doi: 10.3390/cells9112484. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Park HJ, Yun JI, Kim M, Choi K, Lee E, Lee ST. Screening of integrin heterodimers expressed functionally on the undifferentiated spermatogonial stem cells in the outbred ICR mice. Int J Stem Cells. 2020;13:353–363. doi: 10.15283/ijsc20061. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Karimi-Busheri F, Rasouli-Nia A, Weinfeld M. Key issues related to cryopreservation and storage of stem cells and cancer stem cells: protecting biological integrity. Adv Exp Med Biol. 2016;951:1–12. doi: 10.1007/978-3-319-45457-3_1. [DOI] [PubMed] [Google Scholar]
  • 23.Elliott GD, Wang S, Fuller BJ. Cryoprotectants: a review of the actions and applications of cryoprotective solutes that modulate cell recovery from ultra-low temperatures. Cryobiology. 2017;76:74–91. doi: 10.1016/j.cryobiol.2017.04.004. [DOI] [PubMed] [Google Scholar]
  • 24.Park JA, Park S, Choi JK, Han MK, Lee Y. Inhibition of MUC1-C increases ROS and cell death in mouse embryonic stem cells. Int J Stem Cells. 2021;14:180–190. doi: 10.15283/ijsc20089. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Rodin S, Antonsson L, Niaudet C, Simonson OE, Salmela E, Hansson EM, et al. Clonal culturing of human embryonic stem cells on laminin-521/E-cadherin matrix in defined and xeno-free environment. Nat Commun. 2014;5:3195. doi: 10.1038/ncomms4195. [DOI] [PubMed] [Google Scholar]
  • 26.Ahn S, Lee KY, Parker KK, Shin K. Formation of multi-component extracellular matrix protein fibers. Sci Rep. 2018;8:1913. doi: 10.1038/s41598-018-20371-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.O'Connor BB, Pope BD, Peters MM, Ris-Stalpers C, Parker KK. The role of extracellular matrix in normal and pathological pregnancy: future applications of microphysiological systems in reproductive medicine. Exp Biol Med (Maywood) 2020;245:1163–1174. doi: 10.1177/1535370220938741. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Russo MA, Paolillo M, Sanchez-Hernandez Y, Curti D, Ciusani E, Serra M, et al. A small-molecule RGD-integrin antagonist inhibits cell adhesion, cell migration and induces anoikis in glioblastoma cells. Int J Oncol. 2013;42:83–92. doi: 10.3892/ijo.2012.1708. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Li J, Wang G, Wang C, Zhao Y, Zhang H, Tan Z, et al. MEK/ERK signaling contributes to the maintenance of human embryonic stem cell self-renewal. Differentiation. 2007;75:299–307. doi: 10.1111/j.1432-0436.2006.00143.x. [DOI] [PubMed] [Google Scholar]
  • 30.Hamilton WB, Brickman JM. Erk signaling suppresses embryonic stem cell self-renewal to specify endoderm. Cell Rep. 2014;9:2056–2070. doi: 10.1016/j.celrep.2014.11.032. [DOI] [PubMed] [Google Scholar]
  • 31.Li Z, Theus MH, Wei L. Role of ERK 1/2 signaling in neuronal differentiation of cultured embryonic stem cells. Dev Growth Differ. 2006;48:513–523. doi: 10.1111/j.1440-169X.2006.00889.x. [DOI] [PubMed] [Google Scholar]
  • 32.Heo JH, Kang D, Seo SJ, Jin Y. Engineering the extracellular matrix for organoid culture. Int J Stem Cells. 2022;15:60–69. doi: 10.15283/ijsc21190. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Yun W, Kim YJ, Lee G. Direct conversion to achieve glial cell fates: oligodendrocytes and Schwann cells. Int J Stem Cells. 2022;15:14–25. doi: 10.15283/ijsc22008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Lee JH, Lee S, Park HJ, Kim YA, Lee SK. Human liver stem cell transplantation alleviates liver fibrosis in a rat model of CCl4-induced liver fibrosis. Int J Stem Cells. 2021;14:475–484. doi: 10.15283/ijsc21031. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Tissue Engineering and Regenerative Medicine are provided here courtesy of Springer

RESOURCES