Gossypol improves myocardial dysfunction caused by sepsis by regulating histone acetylation

Abstract

Gossypol is a polyphenol from the cotton plant with anti‐inflammatory and anti‐oxidation activities and can also function as a histone deacetylase (HDAC) inhibitor. Sepsis is an inflammatory disease with high mortality. Inflammation, oxidative stress, and epigenetic factors are involved in sepsis and its complications. The biological activities of gossypol strongly suggest the potential effects of gossypol on sepsis. In the present study, the beneficial effects of gossypol on sepsis were evaluated. We established a cecal ligation and puncture (CLP) mouse model of sepsis and treated CLP mice with gossypol. The survival rate, serum level of myocardial injury markers, and myocardial level of oxidation markers were measured. We also administered gossypol to lipopolysaccharide (LPS)‐treated primary cardiomyocytes. The production of pro‐inflammatory cytokines, activation of protein kinase B (AKT) and IκB kinase (IKK), acetylation of histone, and expression of HDACs were measured. Gossypol prevented the death of CLP mice and ameliorated myocardial damage in CLP mice. Moreover, gossypol decreased oxidative factors, while promoting antioxidant production in CLP mice. Gossypol prevented LPS and cytosine‐phosphate‐guanosine‐induced expression of pro‐inflammatory cytokines, suppressed LPS‐induced activation of AKT and IKK, inhibited histone acetylation, and decreased the expression of HDACs. In conclusion, gossypol ameliorates myocardial dysfunction in mice with sepsis.

Study Highlights.

• WHAT IS THE CURRENT KNOWLEDGE ON THE TOPIC?

Gossypol is a polyphenol with anti‐inflammatory, anti‐oxidation, and histone deacetylase inhibitor activities.

• WHAT QUESTION DID THIS STUDY ADDRESS?

Our study aimed to evaluate the effects of gossypol on sepsis.

• WHAT DOES THIS STUDY ADD TO OUR KNOWLEDGE?

Gossypol prevented the death of cecal ligation and puncture (CLP) mice and ameliorated myocardial damage in CLP mice. Gossypol decreased oxidative factors while promoting antioxidant production in CLP mice.

• HOW MIGHT THIS CHANGE CLINICAL PHARMACOLOGY OR TRANSLATIONAL SCIENCE?

Our findings suggest that Gossypol may be used as a new drug for the treatment of myocardial dysfunction with sepsis.

INTRODUCTION

Sepsis is a systemic inflammation caused by infection or injury, and is a major cause of death in hospitals around the world. ¹ , ² Sepsis‐induced myocardial dysfunction (SIMD) is one of the important complications of sepsis. ³ About 60% of septic patients have myocardial dysfunction, and the mortality rate of these patients is up to 70%–90%. ⁴ Presently, there is no targeted treatment for myocardial dysfunction in sepsis, and the precise molecular mechanisms are still unclear.

The mechanisms of myocardial injury in sepsis mainly include oxidative stress, acute inflammatory injury, and mitochondrial dysfunction. ³ , ⁵ , ⁶ , ⁷ In sepsis, bacterial infection activates toll‐like receptors (TLRs), especially TLR‐4, through pathogen‐related molecular patterns such as lipopolysaccharide (LPS), leading to the infiltration of inflammatory cells in myocardial tissue and following myocardial impairments. ⁸ Sepsis can cause cardiac mitochondrial damage through unbalanced oxidative stress and antioxidant defense, which results in overproduction of mitochondrial reactive oxygen species (mtROS), deficient mitochondrial function, and structural rupture of mitochondria. ⁷ Multiple studies have demonstrated that targeting inflammation, oxidative stress, and mitochondrial dysfunction could ameliorate sepsis symptoms. ⁹ , ¹⁰ , ¹¹ , ¹² , ¹³

Epigenetics refers to the regulation of gene expression without changing the DNA sequence. Histone acetylation is one of the major epigenetic mechanisms in eukaryotes and a significant process in the regulation of inflammation. ¹⁴ , ¹⁵ Adding or removing acetyl groups to histone is mediated by histone acetyltransferases (HATs) and histone deacetylases (HDACs) respectively, which can also target non‐histone transcriptional regulators to alter gene expression. It has been described that histone acetylation is associated with the production of pro‐inflammatory cytokines. ¹⁶ , ¹⁷ Histone deacetylation causes condensed nucleosome structure and prevents active transcription. HDAC‐specific inhibitors can inhibit HDAC activities and restore its expression. HDAC inhibitors have been shown to decrease the expression of both pro‐ and anti‐inflammatory mediators and prevent sepsis progression, ¹⁸ demonstrating the potential of HDAC inhibitors against sepsis.

Gossypol is a polyphenolic compound isolated from the cotton plant with various properties including anti‐fertility, ¹⁹ antioxidant, ²⁰ anti‐inflammation, ²¹ antitumor, ²² and antivirus properties. ²³ Studies also described that gossypol could function as an HDAC inhibitor. ²⁴ These activities of gossypol strongly suggest the potential protective effects of gossypol against sepsis and SIMD. We aimed to explore the effects of gossypol on sepsis in the current study.

MATERIALS AND METHODS

Mice and cecal ligation and puncture (CLP)

Wild‐type female C57BL/6 mice aged 8–12 weeks were maintained in a specific pathogen‐free facility, and had free access to food and water. The immune response of female mice is more stable, while male mice vary widely from individual to individual. Thus, only female mice were studied. All animal experiments were performed in accordance with protocols approved by the People's Hospital of Xinjiang Uygur Autonomous Region. The CLP model was the most widely used clinical model to study sepsis ²⁵ and was induced as described previously. ²⁶ Briefly, mice were anesthetized using 2% isoflurane in oxygen. The abdominal wall was incised 1–2 cm in the midline and the cecum was identified. Then the cecum was tightly ligated with a 3‐0 silk tie 1 cm from the tip avoiding bowel obstruction. The cecum was perforated once with a 20‐gauge needle and lightly squeezed to extrude a small amount of feces from the puncture site to ensure complete perforation. The cecum was returned to the peritoneal cavity, and the incision was closed with a continuous suture. Mice received 2 mL lactated Ringer's solution subcutaneously in the dorsal area for fluid resuscitation. Sham mice underwent anesthesia, laparotomy, and wound closure but were not exposed to the CLP procedure.

Gossypol administration

One hour after the LPS challenge, gossypol (dissolved in 2% Tween‐80 in phosphate‐buffered saline [PBS] as a suspension) or vehicle (2% Tween‐80 in PBS) was given intragastrically (i.g.) once. Mouse survival was monitored every 5 days for 25 days.

Measurement of biochemical parameters in the heart

At the end of the study, the animals were euthanized by cervical dislocation, and the hearts were harvested, weighed, and processed for subsequent analyses. Heart tissue homogenates were prepared by high‐speed stirring of heart tissue in a 10‐fold volume (v/w) of ice‐cold PBS or anhydrous alcohol (for estimation of lipids), followed by 16000 g centrifugation at 4°C for 15 min. The supernatant was then collected for subsequent analysis. mtDNA and mitochondrial content were detected by quantitative polymerase chain reaction (qPCR). The detection of ROS (#E004‐1‐1), malondialdehyde (MDA) (#A003‐1‐2), superoxide dismutases (SOD) (#A001‐3‐2), and glutathione (GSH) (#A005‐1‐2) were performed using biochemical kits (NanJing JianCheng Bioengineering Institute, China) according to the kit specifications.

Enzyme‐linked immunosorbent assay (ELISA)

Serum levels of creatine kinase (CK)‐MB, lactate dehydrogenase (LDH), cardiac myosin light chain 1 (cMLC1), and cardiac troponin I (cTnl), and the level of interleukin (IL)‐1β, IL‐6, tumor necrosis factor (TNF)‐α, and IL‐12p40 in the cell culture supernatant, were measured using commercial ELISA kits according to the manufacturer's instructions. All ELISA kits were purchased from Abcam or R&D Biosystem.

Immunoblot assay

The samples were homogenized in the radioimmunoprecipitation assay buffer. After centrifugation the supernatants were subjected to immunoblot analysis as described previously. ²⁷ The antibodies included anti‐phospho‐IκB kinase (IKK)α/β (Ser176/180, #2694, 1:1000, Cell Signaling), anti‐IKKβ (D30C6, 1:1000, Cell Signaling), anti‐phospho‐protein kinase B (AKT) (Ser473, D9E, 1:1000, Cell Signaling), anti‐AKT (C67E7, 1:1000, Cell Signaling), anti‐histone H3 (D1H2, 1:1000, Cell Signaling), anti‐HDAC1 (#2062, 1:1000, Cell Signaling), anti‐HDAC3 (#60538, 1:1000, Cell Signaling), anti‐actin (8H10D10, 1:5000, Cell Signaling), and anti‐Ac‐H3K9 (ab4441, 1:1000, Abcam).

Primary cardiomyocytes

Pierce Primary Cardiomyocyte Isolation Kit (ThermoFisher) was used to isolate the primary cardiomyocytes. The primary cardiomyocytes were pretreated with 50 μM gossypol for 1 h and then treated with 100 ng/mL LPS or 5 nM cytosine‐phosphate‐guanosine (CpG) for 24 h. In certain experiments, the cells were treated with 0.5 μM trichostatin A (TSA).

Real‐time PCR (RT‐PCR)

The total RNA was isolated using TRI reagent (Molecular Research Center). The cDNA was synthesized using RNase H‐reverse transcriptase (Invitrogen). qRT‐PCR was performed using the iCycler Sequence Detection System (Bio‐Rad) and iQTM SYBR Green Supermix (Bio‐Rad). Actb was used as the internal control. The primers used in the present study included: Il6 sense 5′‐CTGATGCTGGTGACAACCAC‐3′, Il6 antisense 5′‐CAGACTT GCCATTGCACAAC‐3′; Tnf sense 5′‐CATCTTCTCAAAATTCGAGTGACAA‐3′, Tnf antisense 5′‐CCAGCTGCTCCTCCACTTG‐3′, Il1b sense 5′‐TGGACCTTCCAGGATGA GGACA‐3′, Il1b antisense 5′‐GTTCATCTCGGAGCCTGTAGTG‐3′; Il12b sense 5′‐ TTGAACTGGCGTTGGAAGCACG‐3′, Il12b antisense 5′‐ CCACCTGTGAGTTCTTCAAA GGC‐3′; Actin sense 5′‐CATTGCTGACAGGATGCAGAAGG‐3′, and Actin antisense 5′‐TGCTGGAAG GTGGACAGTGAGG‐3′.

Statistical analysis

Data were presented as the means ± standard deviation (SD). Statistical analysis was performed using Prism software (Graph‐Pad Prism version 6.01). One‐way ANOVA, two‐way ANOVA, and an appropriate post hoc test were used. A p value <0.05 was considered statistically significant.

RESULTS

Gossypol promoted survival rates and suppressed myocardial injury in mice with sepsis

Gossypol is a polyphenol (Figure 1a) isolated from the cotton plant. We established a CLP model and administered gossypol to CLP mice and evaluated its effects. Mice survival and myocardial injury were measured. As presented in Figure 1b, all CLP mice died on Day12. In contrast, the survival rate of CLP mice treated with gossypol was 70% at the same time point, indicating gossypol promoted the survival rate in CLP mice. We identified significantly elevated serum levels of LDH, CK, cMCLC1, and cTnl in CLP mice (Figure 1c), indicating CLP mice had obvious myocardial damage when compared to sham mice. In contrast, CLP mice treated with gossypol had significantly decreased serum levels of these myocardial injury markers, suggesting gossypol protected CLP mice against myocardial injury. Collectively, these results suggested that gossypol exhibited protective effects in CLP mice.

FIGURE 1.

Gossypol promotes survival rates in mice with sepsis and inhibits the production of markers of myocardial injury. (a) Chemical structure of gossypol. (b) Survival after 25 days of moderate cecal ligation and puncture (CLP) or sham CLP in 8–12‐week‐old female wild‐type mice (n = 10) treated with gossypol (80 mg/kg/day). Survival analyses were carried out with the log‐rank test. Data were pooled from the two experiments performed. (c) Serum levels of creatine kinase (CK)‐MB, lactate dehydrogenase (LDH), cardiac myosin light chain 1 (cMCLC1), and cardiac troponin I (cTnl) are presented as means ± SD. Data are representative of at least three independent experiments. *p < 0.05; **p < 0.01; ***p < 0.005. PBS, phosphate‐buffered saline.

Gossypol suppressed myocardial oxidative stress and rescued mitochondrial function in mice with sepsis

In CLP mice, significantly elevated ROS (Figure 2a) and MDA (Figure 2b) were detected in cardiac tissues. In contrast, gossypol treatment effectively decreased the cardiac ROS and MDA, suggesting gossypol inhibited the production of oxidants. We detected markedly decreased levels of the antioxidants GSH (Figure 2c) and SOD (Figure 2d) in CLP mice while gossypol treatment rescued the level of GSH and SOD. We detected notably reduced cardiac mitochondria content (Figure 2e) and cardiac mtDNA (Figure 2f) in CLP mice. In contrast, both cardiac mitochondria content (Figure 2e) and cardiac mtDNA (Figure 2f) were remarkably enhanced in CLP mice treated with gossypol. Taken together, these results indicated that gossypol protected CLP mice against mitochondrial oxidative stress.

FIGURE 2.

Effects of gossypol intervention on myocardial reactive oxygen species (ROS) and mitochondrial function in mice with sepsis. 8–12‐week‐old female wild‐type mice (n = 10) were induced as moderate cecal ligation and puncture (CLP) or sham CLP and treated with gossypol (80 mg/kg/day). Illustration of levels of serum ROS (a), cardiac malondialdehyde (MDA) (b), cardiac glutathione (GSH) (c), cardiac superoxide dismutases (SOD) (d), cardiac mitochondria content (e), and relative cardiac mitochondrial DNA (mtDNA) (f). Data are presented as mean ± SD. Data are representative of at least three independent experiments. *p < 0.05; **p < 0.01.

Gossypol inhibited production of pro‐inflammatory cytokines

We continued to evaluate the effects of gossypol on cytokine production. We pretreated primary cardiomyocytes with gossypol and then stimulated the cells with LPS. LPS treatment induced robust mRNA production of pro‐inflammatory cytokines including IL‐1β, IL‐6, TNF‐α, and IL‐12p40. In contrast, the mRNA level of these cytokines was significantly decreased in gossypol pretreated primary cardiomyocytes after LPS stimulation (Figure 3a). Similarly, gossypol suppressed CpG‐induced mRNA expression of IL‐1β, IL‐6, TNF‐α, and IL‐12p40 in primary cardiomyocytes (Figure 3b). Correspondingly, we detected remarkably increased IL‐1β, IL‐6, TNF‐α, and IL‐12p40 protein in the supernatant of LPS‐treated primary cardiomyocytes while the protein level of these cytokines was markedly reduced in the cell culture supernatant of gossypol pretreated LPS‐stimulated primary cardiomyocytes (Figure 3c). Therefore, gossypol inhibited LPS and CpG induced production of pro‐inflammatory cytokines.

FIGURE 3.

Gossypol suppresses the induction of pro‐inflammatory cytokines in cardiomyocytes. Primary cardiomyocytes were pretreated with 50 μM gossypol for 1 h. The expression of lipopolysaccharide (LPS) (100 ng/mL) (a) or 5 nM cytosine‐phosphate‐guanosine (CpG) (b) ‐induced cytokines of gossypol‐treated cardiomyocytes were measured by quantitative real‐time polymerase chain reaction (qRT‐PCR). (c) Enzyme‐linked immunosorbent assay (ELISA) of the LPS‐induced cytokines in the supernatants of gossypol‐treated cardiomyocytes for 24 h. All data are presented as fold relative to the Actb mRNA level. Data are presented as mean ± SD. Data are representative of at least three independent experiments. *p < 0.05; **p < 0.01. PBS, phosphate‐buffered saline.

Gossypol suppressed inflammation through regulating HDAC

Next, we explored the underlying mechanisms of the anti‐inflammation activities of gossypol. LPS treatment induced the phosphorylation of IKKα/β and AKT as the amount of p‐IKKα/β and p‐AKT increased with increasing time in primary cardiomyocytes after LPS stimulation (Figure 4a). In contrast, in gossypol pretreated cells, the amount of p‐IKKα/β and p‐AKT was obviously reduced, indicating gossypol prevented the activation of NF‐κB signaling pathways. We further identified decreased Ac‐H3K9 in primary cardiomyocytes after LPS stimulation, while the amount of Ac‐H3K9 was not changed in gossypol‐treated primary cardiomyocytes after LPS stimulation (Figure 4b). These results suggested that gossypol prevented the deacetylation of H3 after LPS stimulation. Interestingly, we detected reduced amounts of HDAC1 and HDAC3 in gossypol‐treated cells (Figure 4c), suggesting gossypol suppressed HDAC1 and HDAC1 expression. To further determine whether gossypol regulated cytokine expression through regulating HDAC expression, we treated cells with TSA, a well‐characterized HDAC inhibitor. As presented in Figure 4d, in the absence of TSA, gossypol successfully prevented LPS induced mRNA expression of IL‐1β, IL‐6, and TNF‐α. In contrast, in the presence of TSA, the inhibitory effects of gossypol on cytokine expression were prevented. Taken together, these results suggested that the suppression of cytokine expression by gossypol was mediated by HDACs.

FIGURE 4.

The suppression of inflammatory genes by gossypol is mainly mediated by histone deacetylases (HDACs). (a) The gossypol‐treated cardiomyocytes were stimulated with lipopolysaccharide (LPS) (1 μg/mL) for the indicated time points. Immunoblotting analysis of the indicated phosphorylated (P‐)IKKα/β, P‐AKT, and total IKKβ plus AKT in whole‐cell lysates. (b, c) Immunoblotting analysis of the indicated Ac‐H3K9 and total H3 and its deacetylases in whole‐cell lysates. (d) The expression of LPS‐induced cytokines in gossypol‐treated cardiomyocytes were measured by quantitative real‐time polymerase chain reaction (qRT‐PCR). All data are presented as fold relative to the Actb mRNA level. Data are presented as mean ± SD. Data are representative of at least three independent experiments. *p < 0.05, ns indicates no statistical significance. DMSO, dimethylsulfoxide; PBS, phosphate‐buffered saline; TSA, trichostatin A.

DISCUSSION

Here we reported that gossypol, a polyphenol isolated from the cotton plant, ameliorated myocardial dysfunction and promoted the survival rate in mice with sepsis. We demonstrated that gossypol suppressed oxidative stress, promoted antioxidants, inhibited LPS‐induced inflammation, and prevented histone deacetylation by decreasing the expression of HDACs. Our findings not only confirmed the anti‐inflammation and anti‐oxidative activities of gossypol but also suggested gossypol could be utilized as a therapeutic drug to treat sepsis.

Sepsis is characterized by dysregulated inflammation with a hyper‐inflammatory phase and a hypo‐inflammatory phase. ²⁸ , ²⁹ , ³⁰ Therefore, therapy approaches targeting these pro‐ and anti‐inflammatory responses are utilized to advance sepsis outcomes. In the present study, we demonstrated that gossypol prevented LPS‐induced production of pro‐inflammatory cytokines, indicating the anti‐inflammation activities of gossypol. The anti‐inflammation activities of gossypol were reported previously. For example, using an LPS‐induced acute lung injury mouse model, Liu and colleagues reported that gossypol attenuated LPS‐induced alterations in the lung and inhibited production of IL‐1β and IL‐6. ³¹ In addition, they revealed that gossypol inhibited the phosphorylation of IκBa, NF‐κB p65, ERK, and p38. Similarly, we found gossypol inhibited the phosphorylation of AKT and IKK, two upstream factors of the NF‐κB signaling pathway, ³² in LPS‐stimulated primary cardiomyocytes, suggesting gossypol prevented LPS‐induced activation of the NF‐kB signaling pathway. It should be interesting to evaluate whether gossypol can inhibit LPS‐induced activation of the MAPK signaling pathway.

Oxidants and antioxidants also play significant roles in the physiopathology of sepsis. The persistent oxidative stress during sepsis induces changes in the mitochondria, which eventually lead to mitochondrial dysfunction. ¹³ , ³³ , ³⁴ Suppression of oxidative stress has been shown to protect against sepsis. For example, Karamese et al. found apigenin decreased oxidative stress in rats with sepsis and inhibited sepsis‐induced spleen injury. ³⁵ In another study, Yim et al. found nanosheet antioxidants significantly promoted the survival rate of mice with sepsis, reduced systemic inflammation, and scavenged ROS. ³⁶ In the present study, we found gossypol suppressed the level of the oxidants ROS and MDA, and promoted the level of the antioxidants GSH and SOD. Gossypol also rescued mitochondria dysfunction in mice with sepsis. Gossypol is an effective and potent natural antioxidant ³⁷ and its anti‐oxidative activities have been well described. ³⁸ It is not surprising that gossypol displayed antioxidant function in sepsis.

Epigenetic modifications have been implicated in sepsis. Regulation of gene transcription is the key factor controlling the pro‐ and anti‐inflammatory phenotype of immune cells during sepsis. ¹⁸ Previous research has revealed that the regulation of pro‐inflammatory cytokine expression by HDAC‐mediated deacetylation is a complex process that involves multiple layers of control. In addition to histone acetylation, HDACs can also regulate cytokine expression by deacetylating non‐histone proteins, such as transcription factors and co‐activators. Studies have shown that HDAC inhibitors can suppress the production of IL‐1β and TNF‐α in macrophages, suggesting that HDACs play a role in controlling cytokine expression. Further research has identified specific HDACs that are involved in this process, including HDAC1 and HDAC2. Our results show that gossypol can restrict the expression of HDAC1 and HDAC3, thus exhibiting a TSA‐like effect. Based on the reduction of the abovementioned HDAC molecules, further inhibition of the activity of these molecules cannot produce a stronger effect. These results suggest that gossypol regulates the expression of pro‐inflammatory cytokines as long as it is dependent on the expression of HDAC molecules. HDAC inhibitors are effective in altering inflammation. The HDAC inhibitors SAHA and TSA have been shown to protect against sepsis. For example, SAHA improved long‐term survival, and attenuated expression of the pro‐inflammatory mediators TNF‐α and IL‐6 in LPS‐induced sepsis. ³⁹ TSA suppressed sepsis‐induced acute lung injury, inflammation, and cell death. ⁴⁰ , ⁴¹ In the present study we found that gossypol prevented deacetylation of histone and decreased expression of HDAC1 and HDAC3 in LPS‐treated primary cardiomyocytes, which correlated with reduced production of pro‐inflammatory cytokines. Interestingly, the inhibitory effects of gossypol on LPS‐induced cytokine production were prevented in the presence of TSA, suggesting gossypol function depended on HDAC by decreasing the total amount of HDAC. However, our findings were based on an in vitro cell model. It would be useful to evaluate the expression and activities of HDACs in gossypol‐treated mice with sepsis.

Multiple studies have shown that gossypol has the potential for preventing and targeting various diseases. ³⁷ , ⁴² As a versatile molecule with prodigious biological activities, gossypol has potential in drug development. Besides in vitro and in vivo studies, clinical trials of gossypol are also being performed. However, further investigation of mechanisms and drug dosages are still needed for the therapeutic exploitation of gossypol. In the current study, gossypol was given intragastrically only once after LPS challenge. The administration route of gossypol could easily be achieved in a clinical setting. In addition, only one‐time administration and its therapeutic effectiveness validate the long‐term efficiency of gossypol if used in patients. Moreover, although gossypol was widely reported to exhibit beneficial effects in various disease models, especially in cancer treatment, its effects on sepsis have rarely been demonstrated. The current findings reveal a novel indication for gossypol.

CONCLUSIONS

Gossypol displays protective effects against sepsis, as evidenced by its functions in suppressing inflammation and oxidative stress, and ameliorating myocardial dysfunctions by regulating HDACs.

AUTHOR CONTRIBUTIONS

X.S., X.L., and D.X. wrote the manuscript. D.X. designed the research. X.S., X.L., and D.X. performed the research. X.S., X.L., and D.X. analyzed the data.

FUNDING INFORMATION

This study was supported by the Natural Science Fund of Xinjiang Uygur Autonomous Region (2020D01C096).

CONFLICT OF INTEREST STATEMENT

The authors declared no competing interests for this work.

Shi X, Lv X, Xiao D. Gossypol improves myocardial dysfunction caused by sepsis by regulating histone acetylation. Clin Transl Sci. 2023;16:2189‐2197. doi: 10.1111/cts.13618

DATA AVAILABILITY STATEMENT

The data that support the findings of this study are available from the corresponding author, Dong Xiao, upon reasonable request.