Abstract
This experiment was conducted to explore the interactions between enzyme preparations and trace element sources on growth performance and intestinal health of broilers chicks. A total of 480 one-day-old healthy male yellow-feather broilers with similar weight were randomly arranged in a 2 × 2 factorial design with 2 kinds of compound trace element sources (inorganic [I] and organic [O] trace element supplemented with 80, 8, 60, 40, 0.15 mg/kg of Fe, Cu, Mn, Zn, and Se, respectively) and 2 levels of enzyme preparations (0 and 200 mg/kg). The 4 groups named I, O, IE, and OE with 6 replicates and 20 birds per replicate. The trail lasted for 28 days. Results showed that the average weight (ABW), average daily gain (ADG) of broilers in IE and OE groups significantly increased while the F/G significantly decreased as compared with group I and O (P < 0.05). Enzyme preparation supplementation, regardless of the trace element sources, significantly increased the duodenal and jejunal endogenous enzyme (e.g., Try and AACT) activity, and improved the morphology and jejunal barrier function evidenced by the increased villus height and MUC-2 mRNA expression (P < 0.05). Sequencing data manifested that enzyme preparations favorably modulated the cecal microflora by increasing bacterial diversity and abundance of short-chain fatty acid (SCFA)-producing bacteria (e.g., Anaerostipes, Anaerofusis, and Pygmaioactor), while decreasing the abundance of harmful bacteria (e.g., Desulfovibrio). Factorial analysis indicated that there were no interactions between enzyme preparation and trace element sources on growth performance and intestinal health of broiler chicks. In conclusion, dietary supplementation with enzyme preparations, regardless of the trace element sources, could enhance endogenous enzyme activity, improve intestinal morphology and barrier functions, and favorably modulate the cecal microflora, thereby improving the intestinal health and growth performance of broiler chicks.
Key words: enzyme preparation, trace element source, growth performance, intestinal health, broiler chick
INTRODUCTION
Unconventional feed ingredients, like grain and wheat, have been widely applied to poultry feed to reduce breeding cost and improve economic benefits (Iji et al., 2001). However, these plant raw materials include plenty of antinutrient factors such as phytic acid, nonstarch polysaccharides (NSPs), and protease inhibitors. The existence of these factors would result in poor nutrient availability and decrease metabolizable energy, which are not conducive to their growth and development (Woyengo and Nyachoti, 2011). In order to eliminate the negative effects of these factors, exogenous enzyme preparations are usually added to the feed of broilers, which could improve nutrients digestibility and intestinal health of broilers, thus promoting growth performance and finally improving the economic benefits (Ravindran and Son, 2011; Slominski, 2011; Leinonen and Williams, 2015; Alagawany et al., 2018). Enzyme preparations generally consist of 2 or more single enzyme such as xylanases, protease and phytase. In general, xylanases are always used to degrade NSPs, reduce intestinal viscosity and increase nutrient availability. Phytase has enabled a more efficient utilization of phytate phosphorous in feed ingredients. Protease is applied to improve the digestibility of proteins and amino acids and thus reducing the excretion of nitrogen, ammonia, nitrate, and nitrite in feces (Slominski, 2011; Leinonen and Williams, 2015; Alagawany et al., 2018). Several studies reported that dietary supplementation with enzyme preparations improved growth performance and nutrient digestibility (Ravindran and Son, 2011; Sitanaka et al., 2018; Aziz et al., 2021).
Trace elements (including iron, copper, manganese, zinc, selenium, etc.) are involved in various physiological processes, for example, animal growth and development and immunity (Bao and Choct, 2009). Meanwhile, trace elements act as catalysts or part of enzymes in the cellular enzyme system. Traditionally, broilers were fed with inorganic trace elements (ITE) due to the advantages of low cost to meet production needs (Bao and Choct, 2009). However, the application of ITE in livestock production is severely limited due to their toxicity and low bioavailability (Ma et al., 2014). In recent years, more and more studies have shown that organic trace elements (OTE) can replace ITE since OTE show more effective to improve the bioavailability of microelements, feed utilization, and growth performance of broilers (Araújo et al., 2019; Zhu et al., 2019).
Generally, it is a standard practice that the inclusion of exogenous xylanases, protease, phytases and trace minerals combined in complete premixes in actual production. However, the potential interactions between individual premix components are often overlooked. Studies in vitro have proven that significant antagonistic interactions between mineral supplements and exogenous enzymes in premixes (Santos et al., 2015). However, little is known about their interactions in vivo and the subsequently effects on growth performance and intestinal health in broilers. Therefore, this study aims to evaluate the interactions between enzyme preparations and trace element sources on growth performance and intestinal health of broilers chicks.
MATERIAL AND METHODS
Animal Care
All procedures were conducted according to the Chinese Guidelines for Animal Welfare and approved by the Animal Care and Use Committee of Zhejiang University (Hangzhou, China).
Experimental Design and Management
A total of 480 one-day-old healthy male yellow-feather broilers with similar initial body weight were placed in 48 cages (100 cm-width × 80 cm-depth × 45 cm-height). The 48 cages were randomly arranged in a 2 × 2 factorial design with 2 kinds of compound trace element sources (inorganic [I] and organic [O] trace element supplemented with 80, 8, 60, 40, 0.15 mg/kg of Fe, Cu, Mn, Zn, and Se, respectively) and 2 levels of enzyme preparations (0 and 200 mg/kg). The 4 groups named I, O, IE, and OE with 6 replicates and the 2 contiguous cages of 20 broilers composed as a replication. The experiment lasted for 28 days. The corn-wheat basal diet was formulated according to the NRC (1994) standard. Enzyme preparation contained xylanase (≥ 100 U/g), protease (≥ 700 U/g), phytase (≥ 300 U/g), β-glucanase (≥ 200 U/g), cellulase (≥ 40 U/g) and amylase (≥ 30 U/g). The composition and nutrient level of basal diets are shown in Table 1. The birds were reared in stainless-steel cages with 23 h of light, and the brooding temperature was maintained at 35°C for the first week and gradually decreased to 26°C and remained unchanged thereafter. The relative humidity in the rearing room was maintained at 50% to 60%. Birds were fed and watered ad libitum. Immunization, disease prevention and disinfection are carried out by routine methods.
Table 1.
Composition and nutrient levels of the basal diets (air-dry basis).
| 1∼28 d | |
|---|---|
| Ingredients | |
| Corn | 31.96 |
| Wheat grain | 30.00 |
| Corn gluten meal | 15.00 |
| Wheat middling | 8.00 |
| Soybean meal | 4.90 |
| Wheat bran | 3.10 |
| Limestone | 3.00 |
| Calcium phosphate | 1.86 |
| Lys.HCl | 0.68 |
| Sodium chloride | 0.30 |
| Choline chloride 50% | 0.15 |
| DL-Met | 0.05 |
| Premix1 | 1.00 |
| Total | 100.00 |
| Nutrient levels2, % | |
| ME/(Mcal/kg) | 2.95 |
| Crude Protein | 19.69 |
| Calcium | 1.60 |
| Total Phosphorus | 0.71 |
| Available Phosphorus | 0.45 |
| Lysine | 1.07 |
| Methionine | 0.45 |
| Fe, mg/kg | 123.13 |
| Cu, mg/kg | 6.27 |
| Mn, mg/kg | 60.29 |
| Zn, mg/kg | 29.64 |
| Se, mg/kg | 0.04 |
Premix provided per kilogram of diet: vitamin A, 100,000 IU; vitamin C, 10,000 mg; vitamin D3, 40,000 IU; vitamin E4, 500 IU; vitamin K3, 750 mg; vitamin B1, 500 mg; vitamin B2, 2,300 mg; vitamin B6, 300 mg; vitamin B12, 2.5mg; nicotinamide, 4,500 mg; calcium pantothenate, 2,200 mg; folic acid, 150 mg; biotin, 1.5 mg.
The analyzed Fe, Cu, Mn, Zn and Se contents in basal diet were 123.13, 6.27, 60.29, 29.64, and 0.04 mg/kg, respectively. All other values were calculated except for crude protein, calcium, Fe, Cu, Mn, Zn, and Se levels.
Growth Performance
The amount of feed and feed surplus for each replicate were recorded weekly. At the experimental period of 28 days, the fasting body weight of broilers in each replicate were recorded, and the average weight (ABW), average daily gain (ADG), average daily feed intake (ADFI) and feed/gain ratio (F/G) were calculated.
Intestinal Morphology Observation
The middle jejunal segments were fixed with 10% formalin solution, embedded in paraffin, sliced and stained with hematoxylin. After Hematoxylin and Eosin (HE) staining, the villus heights (VH, μm) and crypt depths (CD, μm) were measured under an optical microscope, and then the villus heights/crypt depths (VH/CD) were calculated. VH and CD were measured referring to the vertical distance from the tip of the villus to the crypt opening and the crypt opening to the crypt base, respectively. The middle jejunum was fixed in 2.5% glutaraldehyde and used for transmission electron microscopy (TEM). After rinsing, fixing, rinsing, dehydration, infiltration, embedding, sectioning, and staining, micrographs were obtained using a in a Hitachi H-7650 transmission electron microscope.
Intestinal Digestive Enzyme Activity
The chyme in jejunum was weighed and then diluted in 0.9% normal saline (1:9, w/v). After separating at 4°C at 3,500 rpm for 10 min, the supernatants were obtained for the determination of digestive enzyme activities. The activities of trypsin, α-amylase, chymotrypsin and lipase were determined by the corresponding kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China).
Jejunal Tight Junction mRNA Expression
The mRNA expression of jejunal tight junction genes, including ZO-1, claudin-1, claudin-2, Occludin, and MUC-2 was determined using RT-qPCR. Total RNA extraction was extracted in jejunal mucous according to the method described by the method (Zanu et al., 2020). HiScript II One Step qRT-PCR SYBR Green Kit (Vazyme, Nanjing, China) was used for 1-step qRT-PCR. The primers were synthesized by Qingke Biotechnology Co., Ltd (Hangzhou, China) and primer sequence information is shown in Table 2. The relative gene expression level was calculated following the method descried by the study (Zanu et al., 2020).
Table 2.
Primer sequences.
| Gene name | Primers sequence (5′–3′) | Accession No. | Product size |
|---|---|---|---|
| β-actin | CATTGTCCACCGCAAATGCT | NM_205518.2 | 109 |
| AAGCCATGCCAATCTCGTCT | |||
| ZO-1 | CGTAGTTCTGGCATTATTCGT | XM_046925214.1 | 186 |
| TGGGCACAGCCTCATTCT | |||
| Claudin-1 | CCTCCACAGGGAAGGATTAC | NM_001013611.2 | 121 |
| ACCTAGAGTCTGAACTCTGC | |||
| Claudin-2 | CCTACATTGGTTCAAGCATCGTGA | NM_001277622.1 | 131 |
| GATGTCGGGAGGCAGGTTGA | |||
| Occludin | GTCTGTGGGTTCCTCATCGT | XM_025144247.2 | 156 |
| GTTCTTCACCCACTCCTCCA | |||
| MUC-2 | TGAGTCAGGCATAAATCGTGT | XM_040673077.2 | 421 |
| CAGGTCTAAGTCGGGAAGTGTA |
Intestinal Microflora Analysis
The cecum contents were collected in aseptic centrifuge tubes. Microbial genomic DNA was extracted, amplificated and purificated following the manufacturer's protocol. The purified amplicons were sequenced in high throughput using the Illumina MiSeq PE300 platform by Majorbio Bio-technology Co. Ltd. (Shanghai, China). Analysis and visualization of high-throughput sequencing data were performed using the online Majorbio Cloud Platform (www.majorbio.com).
Statistical Analysis
Main effects of enzyme preparation levels and trace element sources and their interactions were analyzed using the multivariate general linear model of SPSS 26.0 software (SPSS 26.0, SPSS Inc., Chicago, IL) following by Tukey test. P < 0.05 was regarded as statistically significant, while P > 0.05 was not considered statistically significant. Tight junction gene expression and α diversity were used to draw pictures by GraphPad 9.0 software (GraphPad 9.0, GraphPad Inc., San Diego, IL), P < 0.05 was marked as *, P < 0.01 was marked as **; P < 0.001 was marked as ***.
RESULTS
Growth Performance
The effects of dietary enzyme preparation and trace element supplementation on growth performance of broilers were presented in Table 3. No interactions between enzyme preparations and trace elements were observed (P > 0.05). Compared with group I and O, broilers chicks fed with enzyme preparation significantly increased ABW and ADG, and decreased F/G (P < 0.05). There were no significant differences in growth performance indexes among other groups (P > 0.05).
Table 3.
Effects of dietary enzyme preparation and trace element sources supplementation on growth performance of broilers.
| Items | ABW, g | ADG, g | ADFI, g | F/G | |
|---|---|---|---|---|---|
| I | 677.84 ± 12.95b | 22.77 ± 0.44b | 45.27 ± 1.78 | 1.99 ± 0.06a | |
| O | 682.39 ± 16.91b | 22.92 ± 0.62b | 44.74 ± 2.14 | 1.95 ± 0.10ab | |
| IE | 709.60 ± 11.07a | 23.89 ± 0.41a | 44.77 ± 1.00 | 1.87 ± 0.04bc | |
| OE | 723.30 ± 11.15a | 24.38 ± 0.41a | 44.00 ± 1.95 | 1.81 ± 0.09c | |
| SEM | 4.05 | 0.14 | 0.31 | 0.02 | |
| P-value | <0.001 | <0.001 | 0.563 | <0.001 | |
| Main effects | |||||
| TE | ITE | 693.72 | 23.33 | 45.02 | 1.93 |
| OTE | 702.84 | 23.65 | 44.37 | 1.88 | |
| EP | -EP | 680.11 | 22.84 | 45.01 | 1.97 |
| +EP | 716.45 | 24.13 | 44.39 | 1.84 | |
| P-value | |||||
| TE | 0.061 | 0.065 | 0.312 | 0.053 | |
| EP | <0.001 | <0.001 | 0.329 | <0.001 | |
| TE*EP interaction | 0.337 | 0.335 | 0.853 | 0.577 | |
In the same column, values with different small letter superscripts mean significant difference (P < 0.05), while with the no letter or same superscripts mean no significant difference (P > 0.05).
Intestinal Digestive Enzyme Activity
There was no interaction between enzyme preparation and trace elements (P > 0.05) on intestinal digestive enzyme activity. Compared with group I and O, chicks fed enzyme preparation significantly increased the Try and AACT activities of jejunum and α-AMS, Try and AACT activities of duodenum (P < 0.05, Tables 4 and 5).
Table 4.
Effects of dietary enzyme preparation and trace element sources supplementation on duodenum digestive enzyme activity of broilers.
| Items | Lps, U/mg | α-AMS, U/mg | Try, U/mg | AACT, U/mg | |
|---|---|---|---|---|---|
| I | 1.91 ± 0.94 | 1.34 ± 0.74b | 2,206.24 ± 252.56c | 1.99 ± 0.36 | |
| O | 2.31 ± 0.22 | 1.67 ± 0.55ab | 2,323.99 ± 149.49bc | 2.04 ± 0.53 | |
| IE | 2.31 ± 0.87 | 2.15 ± 0.60ab | 2,575.84 ± 176.33ab | 2.59 ± 0.92 | |
| OE | 2.85 ± 0.59 | 2.59 ± 0.38a | 2,683.37 ± 173.35a | 3.09 ± 0.89 | |
| SEM | 0.15 | 0.15 | 54.00 | 0.17 | |
| P-value | 0.185 | 0.007 | 0.001 | 0.048 | |
| Main effects | |||||
| TE | ITE | 2.11 | 1.74 | 2,391.04 | 2.29 |
| OTE | 2.58 | 2.13 | 2,503.68 | 2.57 | |
| EP | -EP | 2.11 | 1.50 | 2,265.12 | 2.01 |
| +EP | 2.58 | 2.37 | 2,629.61 | 2.84 | |
| P-value | |||||
| TE | 0.121 | 0.122 | 0.166 | 0.349 | |
| EP | 0.121 | 0.002 | <0.001 | 0.011 | |
| TE*EP interaction | 0.790 | 0.819 | 0.949 | 0.454 | |
In the same column, values with different small letter superscripts mean significant difference (P < 0.05), while with the no letter or same superscripts mean no significant difference (P > 0.05).
Table 5.
Effects of dietary enzyme preparation and trace element supplementation on jejunum digestive enzyme activity of broilers.
| Items | Lps, U/mg | α-AMS, U/mg | Try, U/mg | AACT, U/mg | |
|---|---|---|---|---|---|
| I | 2.03 ± 0.84 | 1.76 ± 0.63 | 2,804.19 ± 181.17b | 3.74 ± 0.44c | |
| O | 2.16 ± 0.83 | 2.26 ± 0.94 | 2,891.34 ± 211.83ab | 3.86 ± 0.85bc | |
| IE | 2.41 ± 0.85 | 2.12 ± 0.58 | 3,039.94 ± 127.18ab | 4.96 ± 0.93ab | |
| OE | 2.58 ± 0.99 | 2.87 ± 0.87 | 3,112.34 ± 176.65a | 5.96 ± 0.71a | |
| SEM | 0.17 | 0.17 | 42.08 | 0.24 | |
| P-value | 0.706 | 0.121 | 0.027 | <0.001 | |
| Main effects | |||||
| TE | ITE | 2.22 | 1.94 | 2,922.07 | 4.35 |
| OTE | 2.37 | 2.57 | 3,002.01 | 4.91 | |
| EP | -EP | 2.10 | 2.01 | 2,847.77 | 3.80 |
| +EP | 2.49 | 2.50 | 3,076.31 | 5.46 | |
| P-value | |||||
| TE | 0.680 | 0.059 | 0.281 | 0.084 | |
| EP | 0.280 | 0.138 | 0.005 | <0.001 | |
| TE*EP interaction | 0.957 | 0.687 | 0.922 | 0.168 | |
In the same column, values with different small letter superscripts mean significant difference (P < 0.05), while with the no letter or same superscripts mean no significant difference (P > 0.05).
Intestinal Morphology
As shown in Table 6, there were no interaction effects between enzyme preparation and trace elements on intestinal morphology (P > 0.05). Compared with group I and O, the VH and V/C ratios of jejunum of broilers in IE and OE groups were significantly increased while CD significantly decreased (P < 0.05). In addition, enzyme preparation supplementation significantly increased the height and density of jejunum microvilli of broilers (Figure 1), and contained multiple clearly visible tight junctions (TJs). Compared with groups I and IE, groups O and OE significantly increased the V/C ratio (P < 0.05, Table 6).
Table 6.
Effects of dietary enzyme preparation and trace element sources supplementation on jejunum morphology of broilers.
| Items | VH, μm | CD, μm | V/C | |
|---|---|---|---|---|
| I | 967.83 ± 11.86b | 162.36 ± 13.16a | 6.00 ± 0.53b | |
| O | 983.37 ± 47.16b | 159.85 ± 12.12a | 6.17 ± 0.41b | |
| IE | 1,084.14 ± 82.85a | 138.12 ± 12.58b | 7.90 ± 0.86a | |
| OE | 1,145.56 ± 81.01a | 129.92 ± 12.99b | 8.79 ± 0.98a | |
| SEM | 16.85 | 3.28 | 0.24 | |
| P-value | <0.001 | <0.001 | <0.001 | |
| Main effects | ||||
| TE | ITE | 1,025.99 | 150.24 | 6.95 |
| OTE | 1,064.47 | 144.89 | 7.48 | |
| EP | -EP | 975.60 | 161.11 | 6.09 |
| +EP | 1,114.85 | 134.02 | 8.35 | |
| P-value | ||||
| TE | 0.094 | 0.244 | 0.048 | |
| EP | <0.001 | <0.001 | <0.001 | |
| TE*EP interaction | 0.311 | 0.532 | 0.176 | |
In the same column, values with different small letter superscripts mean significant difference (P < 0.05), while with the no letter or same superscripts mean no significant difference (P > 0.05).
Figure 1.
Effects of dietary enzyme preparation and trace element sources supplementation on jejunum micromorphology of broilers.
Tight Junction Protein Expression
The mRNA expression level of MUC-2 gene of jejunum in OE group was higher than other groups (P < 0.05, Figure 2). There were no significant differences in the mRNA expression levels of ZO-1, claudin-1, claudin-2, and Occludin (P > 0.05), but the mRNA expression level in the enzyme preparation groups was higher in values than those in the group without enzyme preparation.
Figure 2.
Effect of dietary enzyme preparation and trace element sources supplementation on the mRNA experssions of intestinal tight junction protein of broilers Note: P < 0.05 was marked as *, P < 0.01 was marked as **, P < 0.001was marked as ***.
Intestinal Flora Analysis
The results based on the OTU Venn chart (Figure 3A) showed that there were 1,535, 1,336, 1,530, and 1,461 OTUs in Group I, O, IE, and OE, respectively. The common number of OTUs among the 4 groups was 1066, suggesting that enzyme preparation and trace elements did not cause significant changes in microbial species in cecal contents of chicks. The results of α-diversity analysis (Figure 4) showed that, compared with group O, the Ace, Chao, Shannon and Sobs indices of intestinal flora in group OE were significantly increased. The Shannon index of group IE was obviously higher than that of group I. What's more, compared with group I, the Shannon index in group OE was significantly increased, and the Simpson index was significantly decreased. These results indicated that dietary enzyme preparations supplementation could enrich α-diversity of intestinal flora. The results of principal coordinate analysis (PCoA) based on Bray-Curtis distance and nonmetric multidimensional scaling (NMDS) analysis showed that there were significant differences in microbial communities among 4 groups (P < 0.05, Figure 3B and 3C), indicating that dietary enzyme preparation supplementation could enrich the β-diversity of intestinal flora of chicks.
Figure 3.
The Venn analysis and β-diversity analysis of cecal contents (n = 6/group) Note: (A) Principal Co-ordinates Analysis (PCoA); (B) Nonmetric multidimensional scaling (NMDS); (C) Venn.
Figure 4.
The α-diversity analysis of cecal contents (n = 6/group) Note: (A) Ace index, (B) Chao index, (C) Shannon index, (D) Sobs index, (E) Simpson index. Where P < 0.05 was marked as *, P < 0.01 was marked as **, P < 0.001was marked as ***.
The relative abundance of intestinal flora of chicks was found that, at the phylum level (Figure 5A), the dominant bacteria in the 4 groups were Firmicutes, Actinobacteriota, Bacteroidota and Proteobacteria, which accounted for more than 99%. However, there was no difference among the 4 groups (P > 0.05, Figure 5C). At the genus level (Figure 5B), the dominant bacteria in the 4 groups were Lactobacillus, Faecalibacterium, Bifidobacterium and Ruminococcus_torques_group. After enzyme preparations and trace elements treatment, the relative abundance of Christensenellaceae_r-7_group, Anaerostipes, Anaerofustis and Pygmaiobacter and unclassified_f_Anaerovoracaceae were changed (P < 0.05, Figure 5D).
Figure 5.
The community composition analysis of cecal contents (n = 6/group) Note: (A) Bar chart of species distribution of phylum; (B)Bar chart of species distribution of genus; (C) Analysis of differential flora at the phylum level; (D) Analysis of differential flora at the genus level.
The results of LEfSe (Linear discriminant analysis Effect Size) analysis (Figure 6) showed that, a total of 55 taxon biomarkers were identified with an LDA score > 2.0. There were 3 kinds of dominant bacteria in group I, including g_Desulfovibrio, g_Roseburia and g_UBA1819. Group O contained g_Faecalibacterium, g_Flavonifractor, g_Intestinimonas, g_Dubosiella and g_Eubacterium_hallii_group. Group IE contained 23 dominant bacteria, including g_Anaeroplasma, g_Ruminiclostridium, g_Anaerofilum, g_Anaerofustis, g_Harryflintia, g_Anaerostipes, g_Peptococcus, g_Eubacterium_brachy_group, and g_Candidatus_Soleaferrea. There were 22 dominant bacteria in OE group, such as g_UCG-005, g_Christensenellaceae_R-7_group, g_Ruminococcus, g_CAG-010, g_Gordonibacter, g_Marvinbryantia, and g_Adlercreutzia.
Figure 6.
The abundance analysis of cecal contents (n = 6/group) Note: (A) Linear discriminant analysis Effect Size (LEfSe);(B):LDA score.
DISCUSSION
Previous studies have proved that dietary supplementation of enzyme preparations could improve growth performance of broilers (Slominski, 2011; Figueiredo et al., 2012; Alagawany et al., 2018). It was reported that adding exogenous enzyme preparations in corn-wheat diet significantly improved body weight gain and decreased fed conversion ratios of chicks (Sharifi et al., 2013). The research found that the growth performance of chicks on corn-wheat-soybean diet supplemented with xylanase was obviously increased (Vasanthakumari et al., 2023). Supplemented with exogenous xylanase and phytase in wheat-based diets enhanced growth performance of broilers (Anwar et al., 2023). The results of this experiment showed that dietary enzyme preparations supplementation in corn-wheat diets was beneficial to improve growth performance of broiler chicks, which was consistent with these studies (Vasanthakumari et al., 2023; Santos et al., 2013; Sharifi et al., 2013; Masey et al., 2014). The above results are due to the limited ability of chicks to degrade plant cell walls, so the birds cannot obtain energy without the supplementation of exogenous enzymes. Dietary supplementation with enzyme preparations could eliminate the wrapping effects of cell wall on nutrients, degrade polysaccharide into glucose, improve feed conversion rate, and thus improve growth performance of broiler chicks (Masey et al., 2014). Several studies had found that OTE could replace ITE in broilers production because OTE shown more effective to improve the bioavailability of microelements, feed utilization, and growth performance of broilers (Araújo et al., 2019; Zhu et al., 2019). The study showed that supplementation of phytase and OTE clearly improved growth performance of Labeo rohita fingerlings and there were interaction effects between the 2 factors (Shah et al., 2020). However, we found no interaction between enzyme preparation and trace element in this study, which is not consistent with the above study. Studies in vitro have proven that significant antagonistic interactions between microelement and exogenous enzymes (Santos et al., 2015) while there are no reports on the interaction between the 2 factors of broilers. So, we are unable to compare the results with the Labeo rohita fingerlings experiment.
Intestinal digestive enzyme activity in the contents of anterior end of small intestine is an important indicator for evaluating endogenous enzyme activity, this is because most of the amylase, trypsin and lipase are mainly distributed in the duodenum and jejunum (Jiang et al., 2008). It was reported that dietary supplementation with exogenous protease enhanced endogenous trypsin activity (Ding et al., 2016). Dietary NSP enzymes supplementation significantly had proved to improve the activities of protease, trypsin and α-amylase (Wang et al., 2008). The results of this study showed that dietary enzyme preparations supplementation significantly increased the activities of amylase, trypsin, chymotrypsin, and lipase in the small intestine of chicks. However, previous study found that when exogenous amylase and protease were added to the feed at the same time, the protease activity was decreased, which is contrary to the results of this experimental. This may be due to the fact that exogenous amylase has a certain promoting effect on the secretion of protease, but when the concentration of amylase reaches 2,250 mg/kg, it inhibits the positive reaction of endogenous amylase and protease (Mahagna et al., 1995). The study found that supplemented with selenomethionine significantly improved the activities of pancreatic digestive enzymes of protease, amylase, and lipase (Zhan et al., 2011). Compared with ITE, OTE also could improve intestinal enzyme activity to a certain extent.
The VH, CD, and VH/CD of the small intestine are the most powerful indicators for evaluating the digestion and absorption capacity of nutrients in the intestine. An increase in VH and a decrease in CD could increase the contact area between the small intestine and nutrients, thereby enhancing the ability to digest and absorb feed nutrients (Zhang et al., 2021). Dietary supplemented with exogenous enzymes to wheat diets improved the intestinal morphology of broilers (Rezaeipour et al., 2016). The supplementation of the exogenous multi-enzyme in corn-wheat-soybean diet obviously improved villus height and V/C (Kim et al., 2021). The results of this experiment showed that dietary supplementation with enzyme preparation significantly increased the VH of the small intestinal, decreased the CD, and thus increased the V/C. Compared with ITM, OTM supplementation increased the V/C, which is consistent with the study (Echeverry et al., 2016). OTM supplied in diet as amino acid complexes were more readily absorbed and had a protective effect on villus epithelial cells during the chick stage (De Grand et al., 2020; Wang et al., 2023). These results suggested that enzyme preparations and organic trace elements both could expand the contact area between the small intestine and feed nutrients, thereby improving the digestion and absorption capacity of broilers for nutrients and improving intestinal morphology.
In order to more intuitively and objectively observe the effects of dietary enzyme preparations and trace elements on the intestinal mechanical barrier in chicks, this study was conducted to observe the ultrastructure of the epithelial cells in the jejunum. Cell junction is an important ultrastructure, including TJ, intermediate junction, desmosome, gap junction, and so on (Luissint et al., 2016). TJ is the main connection pathway between intestinal mucosal epithelial cells, which plays a role in closing cell gaps and maintaining the structural and functional integrity of the intestinal barrier. The intermediate junctions, desmosomes, and gap junctions can promote cell adhesion, enhance tissue mechanical properties, and coordinate intercellular movement (Suzuki, 2020). The results of this experiment showed that under the same magnification transmission electron microscope, dietary enzyme preparations and organic trace elements supplementation increased the height and density of jejunal microvilli, and contained multiple clearly visible TJs. The absence of intermediate connections and desmosomes may be due to incomplete fixation during the sample fixation processing.
TJ proteins between intestinal epithelial cells play a crucial role in maintaining the integrity of intestinal epithelial barrier function and cell bypass permeability. TJ proteins are composed of transmembrane proteins such as Occludin, Claudin, and junction adhesion molecules (JAMs), as well as peripheral membrane proteins such as zonal closure proteins (ZO-1, ZO-2) (Landy et al., 2016). The mucous layer protects the gastrointestinal mucosa from mechanical, chemical, and microbial attacks. Mucous-2 (MUC-2) is the most important mucin secreted by intestinal epithelial cells (Willemse et al., 2003). It found that adding exogenous xylanase and protease to diets can alleviate the expression of TJ protein genes that are altered by Eimeria coccidiosis (Lin and Olukosi, 2021). Previous study found that dietary OTM supplementation effectively improve intestinal integrity compared to the inorganic sources of trace element (Ali et al., 2022; Wang et al., 2023) The data of this experiment reported that dietary enzyme preparations and organic microelements supplementation significantly increased the gene expression of MUC-2, while the gene expression of TJ protein also enhanced to a certain extent. It was suggested that dietary supplemented with enzyme preparations and organic trace elements could improve the intestinal epithelial barrier function and integrity.
There are complex and dynamic microbiota in the gastrointestinal tract of poultry, which play a crucial role in the nutrients digestion and absorption, the immune system development and the pathogenic bacteria elimination (Celi et al., 2017; Shang et al., 2018; Yadav and Jha, 2019). Feed plays a crucial role in intestinal health by regulating intestinal flora. Research has shown that exogenous enzymes have been proven to improve the microbial flora, improve the digestion, absorption, and metabolism of nutrients, inhibits the proliferation of pathogenic bacteria, thereby improving health and growth performance of broilers (Yadav and Jha, 2019). The study found that dietary supplemented with phytase and xylanase improved the diversity of intestinal microflora (Maas et al., 2021). It was found that dietary supplemented with OTE could inhibit the effects of potentially harmful bacteria Barnesiellaceae and Clostridiales in the cecum (Dong et al., 2022). The results of our trial showed that adding enzyme preparations and OTE to the diet enriched the diversity of intestinal microflora in broilers. It suggests that enzyme preparations and OTE could improve the digestion and absorption of nutrients and intestinal health by improving the diversity of intestinal microflora.
At the phylum level, Firmicutes, Bacteroides, Proteonactia, and Actinobacteriota are the core bacteria flora of poultry. At the genus level, the most important bacterial genera are Clostridium, Ruminococcus, Lactobacillus, and Bacteroides (Wei et al., 2013; Gron et al., 2018). In this study, the dominant bacteria in experimental chicks were Firmicutes, Bacteroides, Proteonactiria and Actinobaciota, which accounted for 99% at the phylum level. The dominant bacteria at the genus level were Lactobacillus, Faecalibacterium, Ruminococcus_torques_group and Bifidobacterium. Christensenaceae belongs to the phylum Firmicutes, which widely exists in the intestinal mucosa and plays a crucial role in the health of animals with the potential of probiotic (Waters and Ley, 2019). Anaerostipes could degrade inositol in the diet into short chain fatty acids (SCFAs) such as butyrate and propionate, suggesting that Anaerostipes has beneficial effects in promoting intestinal health (Bui et al., 2021). Pygmaiobacter is a SCFA producing bacterium whose high enrichment will increase the production of SCFA (Yang et al., 2022). Anaerovoracaceae is a caproic acid producing bacterium (Baleeiro et al., 2021). The study found that a positive correlation between the abundance of Anaerofusis is positive corrected with the apparent digestibility of crude fiber, suggesting that Anaerofusis may improve nutrient digestibility (Niu et al., 2019). Our study found that dietary supplementation of enzyme preparations and organic trace elements improved the relative abundance of Christensenellacea_r-7_Group, Anaerostipes, Anaerofusis, and Pygmaioactor at the genus level. That implies that enzyme preparations and organic trace elements may promote the intestinal health by accelerating the production of SCFAs.
Desulfovibrio, a kind of Proteonactia, is the main sulfate-reducing bacteria in the intestinal flora. The pathogenic bacteria could reduce sulfate to hydrogen sulfide, which is toxic to the intestinal epithelium and prone to gastrointestinal diseases such as inflammatory bowel disease (IBD) (Chen et al., 2019; Kushkevych et al., 2019) Through LEfSe analysis, it was found that Desulfovibrio was present in the dominant bacteria in Group I, while Desulfovibrio was not present after adding enzyme preparations and organic trace elements. This may be because soluble NSP in feed could increase the viscosity of intestinal chyme which would inhibit nutrient absorption and promote the growth of pathogenic bacteria. The addition of NSP enzymes reduces the relative molecular weight of NSP and reduces intestinal viscosity, thereby inhibiting the growth of pathogenic bacteria (Masey et al., 2014). Ruminococcaceae and Oscillospira are potential probiotics that can produce butyrates (Gophna et al., 2017; Tian et al., 2021). Clostridia is a major symbiotic flora in the intestinal tract, which plays an important role in maintaining the homeostasis of the intestinal environment and effectively alleviates inflammatory and allergic diseases. Its metabolites including butyric acid, secondary bile acid, and indoleacetic acid play a probiotic role by activating intestinal epithelial cells, enhancing intestinal barrier function, and interacting with the immune system (Guo et al., 2020). Dietary supplemented with xylanase had a significantly effects in regulating the intestinal microbiota with a higher relative abundance of Lactobacillus and a lower abundance of E. shigella (harmful bacteria) (Vasanthakumari et al., 2023). The research showed that dietary supplementation with phytase and xylanase improved the interaction between intestinal microorganisms, while increasing the abundance of lactic acid bacteria and bacillus (Maas et al., 2021). It was found that there were 3 dominant bacteria in Group I through LEfSe analysis, one of which was the harmful bacterium–Desulfovibrio. There were 7, 23, and 22 beneficial bacteria in Group O, IE, and OE, respectively. This result suggests that dietary enzyme preparations and trace elements supplementation could promote the proliferation of probiotics, eliminate harmful bacteria, enrich the intestinal flora and improve the intestinal health and growth performance.
CONCLUSION
Dietary supplementation with enzyme preparations, regardless of the trace element sources, could enhance endogenous enzyme activity, improve intestinal morphology and barrier functions, favorably modulate the cecal microflora by increasing the abundance of SCFA-producing bacteria and decreasing enteric pathogens, thereby improving the intestinal health and growth performance of broiler chicks. There were no interactions between enzyme preparations and trace element sources on growth performance and intestinal health of broiler chicks.
ACKNOWLEDGMENTS
This work was funded by the Collaborative Extension Plan for Major Agricultural Technologies in Zhejiang Province (grant no: 2023ZDXT15) and Bureau of Science and Technology of Ninghai County Foundation.
DISCLOSURES
We declare that there are no financial conflicts of interest with other people or organizations.
REFERENCES
- Alagawany M., Elnesr S.S., Farag M.R. The role of exogenous enzymes in promoting growth and improving nutrient digestibility in poultry. Iran J. Vet. Res. 2018;19:157–164. [PMC free article] [PubMed] [Google Scholar]
- Ali F., Saeed K., Fatemeh H. Nano-bio selenium synthesized by Bacillus subtilis modulates broiler performance, intestinal morphology and microbiota, and expression of tight junction's proteins. Biol. Trace Element Res. 2022;200:1811–1825. doi: 10.1007/s12011-021-02767-2. [DOI] [PubMed] [Google Scholar]
- Anwar U., Riaz M., Khalid M.F., Mustafa R., Farooq U., Ashraf M., Munir H., Auon M., Hussain M., Hussain M., Chisti M.F.A., Bilal M.Q., Rehman A., Rahman M.A.U. Impact of exogenous xylanase and phytase, individually or in combination, on performance, digesta Viscosity and carcass characteristics in broiler birds fed wheat-based diets. Animals. 2023;13:278. doi: 10.3390/ani13020278. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Araújo C.S.S., Hermes R.G., Bittencourt L.C., Silva C.C., Araujo L.F., Granghelli C.A., Pelissari P.H., Roque F.A., Leite B.G.S. Different dietary trace mineral sources for broiler breeders and their progenies. Poult. Sci. 2019;98:4716–4721. doi: 10.3382/ps/pez182. [DOI] [PubMed] [Google Scholar]
- Aziz U.R.M., Jamal U., Anwar U., Bilal M.Q., Riaz M., Hussain M., Ahmad S. Effects of potato peels inclusion with exogenous enzymes in broiler diet on growth performance, nutrients digestibility and carcass characteristics. Sci. Prog. 2021;104 doi: 10.1177/00368504211061972. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Baleeiro F.C.F., Kleinsteuber S., Sträuber H. Hydrogen as a co-electron donor for chain elongation with complex communities. Front. Bioeng. Biotechnol. 2021;9 doi: 10.3389/fbioe.2021.650631. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bao Y.M., Choct M. Trace mineral nutrition for broiler chickens and prospects of application of organically complexed trace minerals: a review. Anim. Prod. Sci. 2009;49:269–282. [Google Scholar]
- Bui T.P.N., Mannerås-Holm L., Puschmann R., Wu H., Troise A.D., Nijsse B., Boeren S., Backhed F., Fiedler D., deVos W.M. Conversion of dietary inositol into propionate and acetate by commensal Anaerostipes associates with host health. Nat. Commun. 2021;12:4798. doi: 10.1038/s41467-021-25081-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Celi P., Cowieson A.J., Fru-Nji F., Steinert R.E., Kluenter A.M., Verlhac V. Gastrointestinal functionality in animal nutrition and health: new opportunities for sustainable animal production. Anim. Feed Sci. Technol. 2017;234:88–100. [Google Scholar]
- Chen Y.R., Zhou L.Z., Fang S.T., Long H.Y., Chen J.Y., Zhang G.X. Isolation of Desulfovibrio spp. from human gut microbiota using a next-generation sequencing directed culture method. Lett. Appl. Microbiol. 2019;68:553–561. doi: 10.1111/lam.13149. [DOI] [PubMed] [Google Scholar]
- De Grand A., Leleu S., Delezie E., Rapp C., De Smet S., Goossens E., Haesebrouck F., Van Immerseel F., Ducatelle R. Dietary zinc source impacts intestinal morphology and oxidative stress in young broilers. Poult. Sci. 2020;99:441–453. doi: 10.3382/ps/pez525. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ding X.M., Li D.D., Li Z.R., Wang J.P., Zeng Q.F., Bai S.P., Su Z.W., Zhang K.Y. Effects of dietary crude protein levels and exogenous protease on performance, nutrient digestibility, trypsin activity and intestinal morphology in broilers. Livest. Sci. 2016;193:26–31. [Google Scholar]
- Dong Y.Y., Zhang K.K., Han M.M., Miao Z.Q., Liu C., Li J.H. Low level of dietary organic trace minerals improved egg quality and modulated the status of eggshell gland and intestinal microflora of laying hens during the late production stage. Front. Vet. Sci. 2022;9 doi: 10.3389/fvets.2022.920418. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Echeverry H., Yitbarek A., Munyaka P., Alizadeh M., Cleaver A., Camelo-Jaimes G., Wang P., Rodriguez-Lecompte J.C. Organic trace mineral supplementation enhances local and systemic innate immune responses and modulates oxidative stress in broiler chickens. Poult. Sci. 2016;95:518–527. doi: 10.3382/ps/pev374. [DOI] [PubMed] [Google Scholar]
- Figueiredo A.A., Correia B.A., Ribeiro T., Ponte P.I.P., Falcao L., Freire J.P., Prates J.A.M., Ferreira L.M.A., Fontes C.M.G.A., Lordelo M.M. The effects of restricting enzyme supplementation in wheat-based diets to broilers. Anim. Feed Sci. Technol. 2012;172:194–200. [Google Scholar]
- Gophna U., Konikoff T., Nielsen H.B. Oscillospira and related bacteria-from metagenomic species to metabolic features. Environ. Microbiol. 2017;19:835–841. doi: 10.1111/1462-2920.13658. [DOI] [PubMed] [Google Scholar]
- Gron K., Sandercock B.K., Jumpponen A., Zeglin L.H. The avian gut microbiota: community, physiology and function in wild birds. J. Avian Biol. 2018;49:e01788. [Google Scholar]
- Guo P.T., Zhang K., Ma X., He P.L. Clostridium species as probiotics: potentials and challenges. J. Anim. Sci. Biotechnol. 2020;11:24. doi: 10.1186/s40104-019-0402-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Iji P., Hughes R., Choct M., Tivey D.R. Intestinal structure and function of broiler chickens on wheat-based diets supplemented with a microbial enzyme. Asian Australas. J. Anim. Sci. 2001;14:54–60. [Google Scholar]
- Jiang Z.Y., Zhou Y.M., Lu F.Z., Han Z.Y., Wang T. Effects of different levels of supplementary alpha-amylase on digestive enzyme activities and pancreatic amylase mRNA expression of young broilers. Asian Australas. J. Anim. Sci., 2008;21:97–102. [Google Scholar]
- Kim M., Ingale S.L., Hosseindoust A., Choi Y., Kim K., Chae B. Synergistic effect of exogenous multi-enzyme and phytase on growth performance, nutrients digestibility, blood metabolites, intestinal microflora and morphology in broilers fed corn-wheat-soybean meal diets. Anim. Biosci. 2021;34:1365–1374. doi: 10.5713/ab.20.0663. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kushkevych I., Dordević D., Kollar P., Vitezova M., Drago L. Hydrogen sulfide as a toxic product in the small-large intestine axis and its role in IBD development. J. Clin. Med. 2019;8:1054. doi: 10.3390/jcm8071054. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Landy J., Ronde E., English N., Clark S.K., Hart A.L., Knight S.C., Ciclitira P.J., Al-Hassi H.O. Tight junctions in inflammatory bowel diseases and inflammatory bowel disease associated colorectal cancer. World J. Gastroenterol. 2016;22:3117–3126. doi: 10.3748/wjg.v22.i11.3117. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Leinonen I., Williams A.G. Effects of dietary protease on nitrogen emissions from broiler production: a holistic comparison using Life Cycle Assessment. J. Sci. Food Agric. 2015;95:3041–3046. doi: 10.1002/jsfa.7202. [DOI] [PubMed] [Google Scholar]
- Lin Y., Olukosi O.A. Eimeria exogenous enzymes influenced-induced changes in cecal fermentation profile and gene expression of nutrient transporters in broiler chickens. Animals. 2021;11:2698. doi: 10.3390/ani11092698. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Luissint A.C., Parkos C.A., Nusrat A. Inflammation and the intestinal barrier: leukocyte-epithelial cell interactions, cell junction remodeling, and mucosal repair. Gastroenterology. 2016;151:616–632. doi: 10.1053/j.gastro.2016.07.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ma X.Y., Liu S.B., Lu L., Li S.F., Xie J.J., Zhang L.Y., Zhang J.H., Luo X.G. Relative bioavailability of iron proteinate for broilers fed a casein-dextrose diet. Poult. Sci. 2014;93:556–563. doi: 10.3382/ps.2013-03296. [DOI] [PubMed] [Google Scholar]
- Maas R.M., Deng Y., Dersjant-Li Y., Petit J., Verdegem M.C.J., Schrama J.W., Kokou F. Exogenous enzymes and probiotics alter digestion kinetics, volatile fatty acid content and microbial interactions in the gut of Nile tilapia. Sci. Rep. 2021;11:8221. doi: 10.1038/s41598-021-87408-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mahagna M., Nir I., Larbier M., Nitsan Z. Effect of age and exogenous amylase and protease on development of the digestive tract, pancreatic enzyme activities and digestibility of nutrients in young meat-type chicks. Reprod. Nutr. Dev. 1995;35:201–212. doi: 10.1051/rnd:19950208. [DOI] [PubMed] [Google Scholar]
- Masey N.H.V., Smith J.A., Bedford M.R. Multicarbohydrase enzymes for non-ruminants. Asian Australas. J. Anim. Sci. 2014;27:290–301. doi: 10.5713/ajas.2013.13261. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Niu Q., Li P.H., Hao S.S., Kim S.W., Du T.R., Hua J.D., Huang R.H. Characteristics of gut microbiota in sows and their relationship with apparent nutrient digestibility. Int. J. Mol. Sci. 2019;20:870. doi: 10.3390/ijms20040870. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ravindran V., Son J.H. Feed enzyme technology: present status and future developments. Recent Pat. Food, Nutr. Agric. 2011;3:102–109. doi: 10.2174/2212798411103020102. [DOI] [PubMed] [Google Scholar]
- Rezaeipour V., Hasanpour M., Janitabar M., Abdullahpour R. Effects of two native Iranian wheat cultivars, processing method, and enzyme supplementation on performance, carcass, intestinal morphology, and microbiota activity in broiler chickens. J. Appl. Anim. Res. 2016;45:1–7. [Google Scholar]
- Santos T., Connolly C., Murphy R. Trace element inhibition of phytase activity. Biol. Trace Elem. Res. 2015;163:255–265. doi: 10.1007/s12011-014-0161-y. [DOI] [PubMed] [Google Scholar]
- Santos C.I., Ribeiro T., Ponte P.I.P., Fernandes V.O., Falcao L., Freire J.P., Prates J.A.M., Ferreira L.M.A., Fontes C.M.G.A., Lordelo M.M. The effects of restricting enzyme supplementation in rye-based diets for broilers. Anim. Feed Sci. Technol. 2013;186:214–217. [Google Scholar]
- Shah S.Z.H., Fatima M., Afzal M., Bilal M. Interactive effect of citric acid, phytase and chelated mineral on growth performance, nutrient digestibility and whole-body composition of Labeo rohita fingerlings. Aquaculture Res. 2020;52:842–858. [Google Scholar]
- Shang Y., Kumar S., Oakley B., Kim W.K. Chicken gut microbiota: importance and detection technology. Front. Vet. Sci. 2018;5:254. doi: 10.3389/fvets.2018.00254. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sharifi S.D, Golestani G., Yaghobfar A., Khadem A., Pashazanussi H. Effects of supplementing a multienzyme to broiler diets containing a high level of wheat or canola meal on intestinal morphology and performance of chicks. J. Appl. Poult. Res. 2013;22:671–679. [Google Scholar]
- Sitanaka N.Y., Budino F.E.L., de Oliveira S.R., Boas A.D.C.V., de Moraes J.E., AF Sitanaka N.Y., Lemos Budino F.E., de Oliveira S.R., Chagas Vilas Boas A.D., de Moraes J.E. Enzyme complex supplementation on the preformance of swine in growth and finishing phases. Rev. Caatinga. 2018;31:748–758. [Google Scholar]
- Slominski B.A. Recent advances in research on enzymes for poultry diets. Poult. Sci. 2011;90:2013–2023. doi: 10.3382/ps.2011-01372. [DOI] [PubMed] [Google Scholar]
- Suzuki T. Regulation of the intestinal barrier by nutrients: the role of tight junctions. Anim. Sci. J. 2020;91:e13357. doi: 10.1111/asj.13357. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tian B.M., Zhao J.H., Zhang M., Chen Z.F., Ma Q.Y., Liu H.C., Nie C.X., Zhang Z.Q., An W., Li J.X. Lycium ruthenicum anthocyanins attenuate high-fat diet-induced colonic barrier dysfunction and inflammation in mice by modulating the gut microbiota. Mol. Nutr. Food Res. 2021;65 doi: 10.1002/mnfr.202000745. [DOI] [PubMed] [Google Scholar]
- Vasanthakumari B.L., Gedye K.R., Abdollahi M.R., Di Benedetto M., Sanchez D.G., Wealleans A., Ravindran V. A new monocomponent xylanase improves performance, ileal digestibility of energy and nutrients, intestinal morphology, and intestinal microbiota in young broilers[J] J. Appl. Poult. Res. 2023;32(1):100301. [Google Scholar]
- Wang S.C., Wu S.J., Zhang Y.W., Chen J., Zhou X.H. Effects of different levels of organic trace minerals on oxidative status and intestinal function in weanling piglets. Biol. Trace Elem. Res. 2023;201:720–727. doi: 10.1007/s12011-022-03174-x. [DOI] [PubMed] [Google Scholar]
- Wang M.Q., Xu Z.R., Sun J.Y., Kim B.G. Effects of enzyme supplementation on growth, intestinal content viscosity, and digestive enzyme activities in growing pigs fed rough rice-based diet, Asian Australas. J. Anim. Sci. 2008;21:270–276. [Google Scholar]
- Waters J.L., Ley R.E. The human gut bacteria Christensenellaceae are widespread, heritable, and associated with health. BMC Biol. 2019;17:83. doi: 10.1186/s12915-019-0699-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wei S., Morrison M., Yu Z. Bacterial census of poultry intestinal microbiome. Poult. Sci. 2013;92:617–683. doi: 10.3382/ps.2012-02822. [DOI] [PubMed] [Google Scholar]
- Willemsen L.E.M., Koetsier M.A., van Deventer S.J.H., van Tol E.A.F. Short chain fatty acids stimulate epithelial mucin 2 expression through differential effects on prostaglandin E(1) and E(2) production by intestinal myofibroblasts. Gut. 2003;52:1442–1447. doi: 10.1136/gut.52.10.1442. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Woyengo T.A., Nyachoti C.M. Review: supplementation of phytase and carbohydrases to diets for poultry. Can. J. Anim. Sci. 2011;91:177–192. [Google Scholar]
- Yadav S., Jha R. Strategies to modulate the intestinal microbiota and their effects on nutrient utilization, performance, and health of poultry. J. Anim. Sci. Biotechnol. 2019;10:2. doi: 10.1186/s40104-018-0310-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yang G., Xu C.L., Varjani S., Zhou Y.Y., Wong J.W., Duan GL. Metagenomic insights into improving mechanisms of Fe nanoparticles on volatile fatty acids production from potato peel waste anaerobic fermentation. Bioresour. Technol. 2022;361 doi: 10.1016/j.biortech.2022.127703. [DOI] [PubMed] [Google Scholar]
- Zanu H.K., Kheravii S.K., Morgan N.K., Bedford M.R., Swick RA. Over-processed meat and bone meal and phytase effects on broilers challenged with subclinical necrotic enteritis: Part 2. Inositol phosphate esters hydrolysis, intestinal permeability, hematology, jejunal gene expression and intestinal morphology. Anim. Nutr. 2020;6:488–498. doi: 10.1016/j.aninu.2020.03.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhan X., Qie Y.Z., Wang M., Li X., Zhao R.Q. Selenomethionine: an effective selenium source for sow to improve Se distribution, antioxidant status, and growth performance of pig offspring. Biol. Trace Elem. Res. 2011;142:481–491. doi: 10.1007/s12011-010-8817-8. [DOI] [PubMed] [Google Scholar]
- Zhang B., Liu N., Hao M.L., Zhou J.H., Xie Y.X., He Z. Plant-derived polysaccharides regulated immune status, gut health and microbiota of broilers: a review. Front. Vet. Sci. 2021;8 doi: 10.3389/fvets.2021.791371. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhu Z.P., Yan L., Hu S.D., An S., Lv Z.Z., Wang Z.G., Wu Y.M., Zhu Y.T., Zhao M., Gu C.S., Zhang A.R. Effects of the different levels of dietary trace elements from organic or inorganic sources on growth performance, carcass traits, meat quality, and faecal mineral excretion of broilers. Arch. Anim. Nutr. 2019;73:324–337. doi: 10.1080/1745039X.2019.1620050. [DOI] [PubMed] [Google Scholar]






