In the original publication [1], there was a mistake in Figures 1–6, the marker labels of the DNA ladder in all Figures 1–6 were a little off.
To the correct version appears below.
Figure 6.
Direct detection of T. tenax among clinical samples without prior DNA extraction. Lane 1: nuclease-free water as a negative control; lane 2: positive controls with 100 ng T. tenax genomic DNA; lanes 3–10: eight microscopically confirmed trichomonad samples of individually owned pet dogs containing two cells per sample. LAMP results are detected by gel electrophoresis. One of three repeats is presented.
The marker labels of DNA ladder in Figures 1–6 should be the same as those in the corrected Figure 6 showed above.
In the original publication [1], there was a mistake in Table 1, as published.
“LP (backward loop primer)” in the fourth line of Table 1 was wrong.
The corrected content appears below.
Table 1.
Loop-mediated isothermal amplification (LAMP) primer sequence for detection of T. tenax.
| Name of Primer | Primer Sequence (5′–3′) |
|---|---|
| FIP (forward inner primer) | GTCATGATGTATGCAACTCCGG-TCCTCACACGATGAAGAACG |
| BIP (backward inner primer) | GGTTAATCTTTGAATGCAAATTGCG-TGTACTGTTACACGCATGCTTCT |
| LF (forward loop primer) | ACATTATGCCACGTTCTTCATCG |
| LB (backward loop primer) | TGCGCTAAACTTGGCTTCGG |
| F3 (forward outer primer) | AGCAATGGATGTCTTGGC |
| B3 (backward outer primer) | GCAGACAACGTAAGTTTGT |
There was an error in the original publication [1]. “LF, and LP (Table 1).” in the fourth line of Section 2.2. LAMP Reaction on page 2 was wrong.
A correction has been made to Section 2.2. LAMP Reaction on page 2:
The LAMP primers targeting the ITS and 5.8S rRNA gene of T. tenax (GenBank Accession No. U86615) were designed using the software Primer explorer V.5 (http://primerexplorer.jp (accessed on 28 February 2020). These include FIP and BIP, F3 and B3, LF, and LB (Table 1). Multiple sequence alignment using software CLUSTAL 1.2.4 (Clustal Omega; https://www.ebi.ac.uk/Tools/msa/clustalo/ (accessed on 28 February 2020) was carried out on the closely related protozoan T. vaginalis, to check for specificity.
The authors state that the scientific conclusions are unaffected. This correction was approved by the Academic Editor. The original publication has also been updated.
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
Reference
- 1.Matthew M.A., Christie J., Yang N., Yao C. A loop-mediated isothermal amplification (LAMP) assay specific to Trichomonas tenax is suitable for use at point-of-care. Microorganisms. 2022;10:594. doi: 10.3390/microorganisms10030594. [DOI] [PMC free article] [PubMed] [Google Scholar]