Table 1. Cell lines and reagents used in this study.
N/A, not applicable; WB, western blot; IHC, immunohistochemistry.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Kidney tissue (Mus musculus) | Pax3-Cre strain with Dlg1+/+ alleles | [39] | Wild type | C57BL/6J-CBA/J mixed background |
| Kidney tissue (Mus musculus) | Pax3-Cre strain with Dlg1F/F alleles | [39] | Pax3Cre-Dlg1 F/F | C57BL/6J-CBA/J mixed background |
| Cell line (Mus musculus) | IMCD3 Flp-In | [45] | Wild type (parental) | |
| Cell line (Mus musculus) | IMCD3 Flp-In w/cilia-BioID2 | [45] | Wild type | |
| Cell line (Mus musculus) | IMCD3 Flp-In w/BioID2 | [45] | Wild type | |
| Cell line (Mus musculus) | mCCD | [101] | Wild type (parental) | cl1 parental cells |
| Cell line (Homo sapiens) | HEK293T | ATCC | Cat. #CRL-3216 | |
| Cell line (Mus musculus) | IMCD3 Flp-In w/DLG1-BioID2 | This study | Pool | Generated by Flp-FRT recombination |
| Cell line (Mus musculus) | IMCD3 Flp-In w/cilia-BioID2 Dlg1−/− | This study | Pool of knockout | Generated by CRISPR/Cas9 methodology |
| Cell line (Mus musculus) | IMCD3 Flp-In w/BioID2 Dlg1−/− | This study | Pool of knockout | Generated by CRISPR/Cas9 methodology |
| Cell line (Mus musculus) | mCCD Dlg1−/− | This study | Clone A8 | Generated by CRISPR/Cas9 methodology |
| Cell line (Mus musculus) | IMCD3 Flp-In w/cilia-BioID2 Dlg1−/− w/mCherry-DLG1 | This study | Pool/rescue line | Generated by lentiviral transduction |
| Cell line (Mus musculus) | mCCD Dlg1−/− w/mCherry-DLG1 | This study | Pool/rescue line | Generated by lentiviral transduction |
| Cell line (Mus musculus) | mCCD Dlg1−/− w/mCherry-DLG1T507R | This study | Pool/mutant line | Generated by lentiviral transduction |
| Cell line (Homo sapiens) | hTERT-RPE1 w/SMO-tRFP | [89] | RPE1 SMO-tRFP | |
| Strain, strain background (Escherichi a coli) | DH10B | Lab stock | N/A | |
| Sequence-based reagent | M. musculus Dlg1 exon 5 sgRNA target sequence | Eurofins Genomics | sgRNA 1 | 5’-TTCTCCACAAGTCACAAATG-3’ |
| Sequence-based reagent | M. musculus Dlg1 exon 8 sgRNA target sequence | Eurofins Genomics | sgRNA 2 | 5’-TTGAGTCATCTCCAATGTGT-3’ |
| Sequence-based reagent | M. musculus Dlg1 exon 9 sgRNA target sequence | Eurofins Genomics | sgRNA 3 | 5’-TGCGATTGTATGTGAAAAGG-3’ |
| Sequence-based reagent | M. musculus Dlg1 exon 14 sgRNA target sequence | Eurofins Genomics | sgRNA 4 | 5’-GGGTCGATATTGCGCAACGA-3’ |
| Sequence-based reagent | M. musculus Gapdh RT-qPCR primer sequence | Eurofins Genomics | N/A | sense 5’-TGTCCGTCGTGGATCTGAC-3’; antisense 5’-CCTGCTTCACCACCTTCT TG-3’ |
| Sequence-based reagent | M. musculus 18S rRNA RT-qPCR primer sequence | Eurofins Genomics | N/A | sense 5’-GCAATTATTCCCCATGAACG-3’; antisense 5’-AGGGCCTCACTAAACCA TCC-3’ |
| Sequence-based reagent | M. musculus Dlg1 RT-qPCR primer sequence | Eurofins Genomics | N/A | sense 5’-CGAAGAACAGTCTGGGCCTT-3’; antisense 5’-GGGGATCTGTGTCAGTGTGG-3’ |
| Sequence-based reagent | M. musculus Dlg2 RT-qPCR primer sequence | Eurofins Genomics | N/A | sense 5’-TGCCTGGCTGGAGTTTACAG-3’; antisense 5’-TTTTACAATGGGGCCTCC GC-3’ |
| Sequence-based reagent | M. musculus Dlg3 RT-qPCR primer sequence | Eurofins Genomics | N/A | sense 5’-GAGCCAGTGACACGACAAGA-3’; antisense 5’-GCGGGAACTCAGAGATG AGG-3’ |
| Sequence-based reagent | M. musculus Dlg4 RT-qPCR primer sequence | Eurofins Genomics | N/A | sense 5’-GGGCCTAAAGGACTTGGCTT-3’; antisense 5’-TGACATCCTCTAGCCCCA CA-3’ |
| Sequence-based reagent | Rattus norvegicus Dlg1 PCR primer | Eurofins Genomics | rDLG1.kpnI | 5’-CCGGTACCCCGGTCCGGAAGCAAGATAC-3’ |
| Sequence-based reagent | Rattus norvegicus Dlg1 PCR primer | Eurofins Genomics | rDLG1.notI | 5’-CCGCGGCCGCTCATAATT TTTCTTTTGCTGGGACCCAG -3’ |
| DNA plasmid | pSpCas9(BB)-2A-Puro (PX459) V2.0 | Addgene | Cat. #62988, pSpCas9 | Expression vector, CRISPR |
| DNA plasmid | gRNA 1/pSpCas9 | This study | pSpCas9-gRNA 1 | Expression vector, CRISPR |
| DNA plasmid | gRNA 2/pSpCas9 | This study | pSpCas9-gRNA 2 | Expression vector, CRISPR |
| DNA plasmid | gRNA 3/pSpCas9 | This study | pSpCas9-gRNA 3 | Expression vector, CRISPR |
| DNA plasmid | gRNA 4/pSpCas9 | This study | pSpCas9-gRNA 4 | Expression vector, CRISPR |
| DNA plasmid | Mus musculus SDCCAG3/pCMV6-Myc-DDK | Origene | Cat. #MR217984, FLAG-MYC-SDCCAG3 | Expression vector |
| DNA plasmid | Homo sapiens IFT20/pcDNA5.1-6xHis-3xFLAG-TEV | Made by Michael Tascher from Esben Lorentzen’s lab using standard approaches as in [61] | HFT-IFT20 | Expression vector |
| DNA plasmid | pEGFP-C1 | Clontech | eGFP | Expression vector |
| DNA plasmid | Mus musculus IFT20/pEGFP-N1 | [13] | IFT20-eGFP | Expression vector |
| DNA plasmid | Rattus norvegicus DLG1/pEGFP-C1 | [92] | eGFP-DLG1 | Expression vector, DLG1 insert is isolated from rat brain [93] |
| DNA plasmid | pENTR220-mCherry-C1 | [93] | N/A | Gateway entry vector |
| DNA plasmid | pCDH-EF1a-Gateway-IRES-BLAST | [93] | pCHD | Gateway destination vector for generating lentiviral expression vector |
| DNA plasmid | pMD2.G | [98] | N/A | Lentiviral packaging vector |
| DNA plasmid | pCMVΔ-R8.2 | [98] | N/A | Lentiviral packaging vector |
| DNA plasmid | Rattus norvegicus DLG1/pENTR22 0-mCherry-C1 | This study | pENTR220-mCherry-DLG1 | Gateway entry vector, cloned in KpnI and NotI sites |
| DNA plasmid | Rattus norvegicus mCherry-DLG1/pCDH-EF1a-Gateway-IRES-BLAST | This study | pCDH-mCherry-DLG1 | Lentiviral expression vector, generated with Gateway LR reaction using pENTR220-mCherry-DLG1 and pCDH plasmids |
| DNA plasmid | Rattus norvegicus mCherry-DLG1T507R/pCDH-EF1a-Gateway-IRES-BLAST | This study | pCDH-mCherry-DLG1T507R | Lentiviral expression vector, Generated by GenScript |
| Antibody | Anti-alpha-tubulin (mouse monoclonal) | Sigma-Aldrich | Cat. #T5168 | WB (1:10000) |
| Antibody | Anti-acetylated alpha-tubulin (mouse monoclonal) | Sigma-Aldrich | Cat. #T7451 | IFM (1:2000) IHC (1:2000) |
| Antibody | Anti-acetylated alpha-tubulin (rabbit monoclonal) | Abcam | Cat. #ab179484 | IFM (1:2000) |
| Antibody | Anti-ARL13B (rabbit polyclonal) | Proteintech | Cat. #17711-1-AP | IFM (1:500) |
| Antibody | Anti-DLG1 (rabbit polyclonal) | Abcam | Cat. #ab300481 | IFM (1:750) WB (1:1000) |
| Antibody | Anti-DLG1 (rabbit polyclonal) | Thermo Scientific | Cat. #PA1-741 | WB (1:600) |
| Antibody | Anti-E-Cadherin (rabbit polyclonal) | Cell Signaling Technology | Cat. # 3195 | IFM (1:1000) |
| Antibody | Anti-FLAG (mouse monoclonal) | Sigma-Aldrich | Cat. #F1804 | WB (1:1000) |
| Antibody | Anti-GAPDH (rabbit polyclonal) | Cell Signaling Technology | Cat. #2118 | WB (1:1000) |
| Antibody | Anti-GFP (chicken polyclonal) | Abcam | Cat. #ab13970 | WB (1:1000) |
| Antibody | Anti-GFP (rabbit polyclonal) | Sigma-Aldrich | Cat. #SAB4301138 | WB (1:500) |
| Antibody | Anti-IFT20 (rabbit polyclonal) | Proteintech | Cat. #13615-1-AP | IFM (1:200) IHC (1:100) WB (1:500) |
| Antibody | Anti-PALS1 (mouse monoclonal) | Santa Cruz Biotechnology | Cat. #sc-365411 | IFM (1:1000) |
| Antibody | Anti-PC2 (rabbit polyclonal) | PKD Research Resource Consortium | N/A | IFM (1:1000) WB (1:600) |
| Antibody | Anti-PC2 (mouse monoclonal) | Santa Cruz Biotechnology | Cat. #sc-28331 | IFM (1:500) WB (1:1000) |
| Antibody | Anti-SDCCAG3 (rabbit polyclonal) | Proteintech | Cat. #15969-1-AP | IFM (1:600) IHC (1:100) WB (1:1000) |
| Antibody | Anti-SMAD2 (rabbit polyclonal) | Cell Signaling Technology | Cat. #5339 | WB (1:200) |
| Antibody | Anti-pSMAD2Ser465/467 (rabbit polyclonal) | Cell Signaling Technology | Cat. #3108 | WB (1:200) |
| Antibody | Anti-rSEC8 (mouse monoclonal) | Enzo Life Sciences | Cat. #ADI-VAM-SV016 | IFM (1:1000) WB (1:2000) |
| Antibody | Anti-TAK1 (rabbit polyclonal) | Cell Signaling Technology | Cat. #4505 | WB (1:300) |
| Antibody | Anti-pTAK1Ser412 (mouse monoclonal) | Bioss Antibodies | Cat. #bs-3435R | WB (1:200) |
| Antibody | Anti-pTAK1Thr184/187 (mouse monoclonal) | Bioss Antibodies | Cat. #bs-3439R | WB (1:200) |
| Antibody | Anti-Mouse-AF488 (donkey polyclonal) | Invitrogen | Cat. #A-21202 | IFM (1:600) |
| Antibody | Anti-Mouse-AF568 (donkey polyclonal) | Invitrogen | Cat. # A-10037 | IFM (1:600) |
| Antibody | Anti-Rabbit-AF488 (donkey polyclonal) | Invitrogen | Cat. # A-21206 | IFM (1:600) |
| Antibody | Anti-Rabbit-AF568 (donkey polyclonal) | Invitrogen | Cat. #A-10042 | IFM (1:600) |
| Antibody | Anti-Chicken-HRP (goat polyclonal) | Invitrogen | Cat. #A-16054 | WB (1:6000) |
| Antibody | Anti-Mouse-HRP (goat polyclonal) | Agilent Technologies, Inc. | Cat. #P0447 | WB (1:10000) |
| Antibody | Anti-Rabbit-HRP (swine polyclonal) | Agilent Technologies, Inc. | Cat. #P0399 | WB (1:10000) |
| Peptide inhibitor | DLG-specific inhibitor | WuXi ApTtec (Shanghai, China) | AVLX-144 | Tat-N-dimer; described in [52, 53] |
| Peptide inhibitor | DLG-specific inhibitor | WuXi ApTtec (Shanghai, China) | Re-Tat-N-dimer | Described in [52, 53] |
| Peptide inhibitor | non-PDZ-binding control | WuXi AppTec (Shanghai, China) | AVLX-144-AA | Described in [52, 53] |
| Secondary detection | Streptavidin, Alexa Fluor 488 Conjugate | Invitrogen | Cat. #S32354 | IFM (1:1000) |
| Fluorescent stain | DAPI | Sigma Aldrich | Cat. #D9542 | IFM (1:5000) |