| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Mouse monoclonal anti-V5 Spike (E9H8O) | Cell Signaling Technology | Cat#80076S; RRID: AB_2920661 |
| Rabbit monoclonal anti-V5 Spike | Cell Signaling Technology | Cat#13202S; RRID: AB_2687461 |
| Mouse monoclonal anti-VSV-M (23H12) | Absolute Antibody | Cat#Ab01404–2.0 |
| Mouse monoclonal anti-beta Actin | Abcam | Cat#ab8226; RRID: AB_306371 |
| IRDye 800CW Goat anti-Mouse IgG (H + L) | LI-COR | Cat#926–32210; RRID: AB_621842 |
| IRDye 680CW Goat anti-Rabbit IgG (H + L) | LI-COR | Cat#925–68071; RRID: AB_2721181 |
| Bamlanivimab | Lilly Pharma | LY-CoV555 700 mg; Lot#D336907A |
| Imdevimab | Roche | REGN10897 1332 mg; Lot#N7534 |
| Casivirimab | Roche | REGN10933 1332 mg; Lot#N7533 |
| Bebtelovimab | Cell Sciences | LY-CoV1404/LY3853113 100 μg; Cat#CPC539B |
| Bacterial and virus strains | ||
| NEB® 5-alpha Competent E. coli (High Efficiency) | New England BioLabs | Cat#C2987H |
| XL2-Blue MRF’ TM Ultracompetent cells | Agilent Technologies | Cat#200151 |
| VSVΔG(GFP)∗VSV-G | Prof. Karl-Klaus Conzelmann, Institute of Virology, LMU Munich, Germany | N/A |
| BetaCoV/Netherlands/01/NL/2020 | European Virus Archive | N/A |
| B.1.1.529, BA.5 | Prof. Dr. Florian Schmidt, University of Bonn | N/A |
| hCoV-19/USA/CO-CDPHE-2102544747/2021, lineage B.1.1.529, BA.2 | BEI database | Cat#NR-56520 |
| Biological samples | ||
| Human sera | This study | N/A |
| Chemicals, peptides, and recombinant proteins | ||
| DAPI | Sigma-Aldrich | Cat#D9542-1MG; CAS: 28718-90-3 |
| L-Glutamine | PANBiotech | Cat#P04-80100 |
| Penicillin-Streptomycin | PANBiotech | Cat#P06-07100 |
| Complete ULTRA inhibitor cocktail tablet | Roche | Cat#05892791001 |
| 2-Mercaptoethanol | Sigma-Aldrich | Cat#M6250-100ML |
| Polyethyleneimine (PEI) | Sigma-Aldrich | Cat#408727-100ML |
| 4% Paraformaldehyde (PFA) | ChemCruz | Cat#sc-281692 |
| 4X Protein Sample Loading Buffer | LI-COR | Cat#928-40004 |
| Tween 20 | Sigma-Aldrich | Cat#P7949-500ML |
| HEPES | Sigma-Aldrich | Cat#H3375-250G |
| NaCl | Sigma-Aldrich | Cat#106404 |
| Triton X-100 | Sigma-Aldrich | Cat#T9284-100ML |
| Ethylenediaminetetraacetic acid (EDTA) | Sigma-Aldrich | Cat#EDS-100G |
| Trypsin/EDTA 0.05%/0.02% | PANBiotech | Cat#P10-023100 |
| Dulbecco’s Phosphate Buffered Saline (PBS) | Thermo Fisher | Cat#14190094 |
| Poly-L-Lysine | Sigma-Aldrich | Cat#P6282-5MG |
| Fetal Bovine Serum | Thermo Fisher | Cat#10270106 |
| 0.5% Trypsin-EDTA | Thermo Fisher | Cat#15400054 |
| Blocker Casein in PBS | Thermo Fisher | Cat#37528 |
| Phire Hot Start II DNA-Polymerase | Thermo Fisher | Cat#F122S |
| dTTP (10 mM) | Invitrogen | Cat#18255018 |
| dATP (10 mM) | Invitrogen | Cat#18252015 |
| dCTP (10 mM) | Invitrogen | Cat#18253013 |
| dGTP (10 mM) | Invitrogen | Cat#18254011 |
| NEBuilder® HiFi DNA Assembly Master Mix | New England BioLabs | Cat#E2621L |
| Camostat -mesylat | Sigma-Aldrich | Cat#SML0057-10MG |
| Aloxistatin (E64d) | Selleckchem | Cat#S7393-5MG |
| Sodium Pyruvate | Thermo Fisher | Cat# 11360070-100mM |
| Gibco™ Puromycin-Dihydrochlorid | Thermo Fisher | Cat# A1113803-1mL |
| Blasticidin | InvivoGen | Cat#ant-bl-05-50mg |
| TaqMan™ Fast Virus 1-Step Master Mix | Thermo Fisher | Cat#4444430-10mL |
| Critical commercial assays | ||
| Q5 Site-Directed Mutagenesis Kit | New England BioLabs | Cat#E0554 |
| COVID-19 Spike-ACE2 Binding Assay Kit | RayBiotech | Cat#QHD43416 |
| RNeasy Plus Mini Kit (50) | Qiagen | Cat#74134 |
| QIAamp Viral RNA Mini Kit (50) | Qiagen | Cat#52904 |
| Experimental models: Cell lines | ||
| Human: HEK293T cells | ATCC | CRL-3216; RRID: CVCL_0063 |
| Human: CaCo-2 cells | ATCC | HTB-37; RRID: CVCL_0025 |
| Human: A549 cells | ATCC | CCL-185; RRID: CVCL_0023 |
| Mouse: I1 Hybridoma cells | ATCC | CRL-2700; RRID: CVCL_G654 |
| Monkey: Vero E6 | ATCC | ATCC Cat# CRL-1586; RRID: CVCL_0574 |
| Oligonucleotides | ||
| Primers for site-directed mutagenesis of the Hu-1 and BA.2 Spike, see Table S1 | This paper | N/A |
| Primers for deletion of IRES-GFP from pCG-SARS-CoV-2 Spike expression constructs Fw: CCGGATCCTGAGAACTTCAGGGTGAGTTTG |
Biomers.net | GFPdel_F |
| Primers for deletion of IRES-GFP from pCG-SARS-CoV-2 Spike expression constructs Rev: TAGGGGGGGGGGCGGAAT |
Biomers.net | GFPdel_R |
| Primer/Probe for qRT-PCR of Human cathepsin L: TaqMan™ Gene Expression Assay (FAM-MGB) Hs00964650_m1 |
Thermo Fisher | Cat#4331182 |
| Primer/Probe for qRT-PCR of Human TMPRSS2: TaqMan™ Gene Expression Assay (FAM-MGB) Hs01122322_m1 |
Thermo Fisher | Cat#4331182 |
| Primer/Probe for qRT-PCR of Human GAPDH: TaqMan™ Gene Expression Assay (VIC-TAMRA) |
Thermo Fisher | Cat#4310884E |
| Synthetic SARS-CoV-2-RNA to use as quantitative standard | Twist Bioscience | Cat#102024 |
| Primer for qRT-PCR of N of SARS-CoV-2: Fw: TAATCAGACAAGGAACTGATTA |
Biomers.net | HKU-NF |
| Primer for qRT-PCR of N of SARS-CoV-2: Rev: CGAAGGTGTGACTTCCATG |
Biomers.net | HKU-NR |
| Probe for qRT-PCR of N of SARS-CoV-2: 5′-6-carboxyfluorescein (FAM)-GCAAATTGTGCAAT TTGCGG-6-carboxytetramethylrhodamine (TAMRA)-3′ |
Biomers.net | HKU-NP |
| Recombinant DNA | ||
| Plasmid: pCG_SARS-CoV-2-Hu-1-Spike C-V5-IRES_eGFP (YP_009724390.1) | This study | N/A |
| Plasmid: pCG_SARS-CoV-2-BA.1-Spike C-V5-IRES_eGFP | This study | N/A |
| Plasmid: pCG_SARS-CoV-2-BA.2-Spike C-V5-IRES_eGFP | This study | N/A |
| Plasmid: pCG_SARS-CoV-2-BA.2.12.1-Spike C-V5-IRES_eGFP | This study | N/A |
| Plasmid: pCG_SARS-CoV-2-BA.4/5-Spike C-V5-IRES_eGFP | This study | N/A |
| Plasmid: pCSDest_hTMPRSS2 | Addgene | Addgene plasmid # 53887; http://n2t.net/addgene:53887; RRID:Addgene_53887 |
| Plasmid: pcDNA3.1_Cathepsin L | Addgene | Addgene plasmid # 11250; http://n2t.net/addgene:11250; RRID:Addgene_11250 |
| Plasmid: pcDNA3.1_Cathepsin B | Addgene | Addgene plasmid # 11249; http://n2t.net/addgene:11249; RRID:Addgene_11249 |
| Plasmid: pCG_ACE2_IRES_eGFP | This study | N/A |
| Software and algorithms | ||
| GraphPad Prism Version 9.2 | GraphPad Software, Inc. |
https://www.graphpad.com RRID: SCR_002798 |
| LI-COR Image Studio Version 5.2 | LI-COR | www.licor.com/RRID: SCR_015795 |
| CorelDRAW 2021 (64-Bit) | Corel Corporation | www.coreldraw.com/RRID: SCR_014235 |
| BioTek Gen5 3.04 | Agilent Technologies | www.biotek.com/RRID:SCR_017317 |
| Fiji 1.53 | National Institutes of Health (NIH) |
ImageJ.nih.gov/ij/ RRID: SCR_003070 |
| PyMol Version 2.4 | Schrödinger | https://pymol.org/2//RRID:SCR_000305 |
| Other | ||
| Dulbecco’s Modified Eagle Medium | Thermo Fisher | Cat#41965039 |
| Roswell Park Memorial Institute Medium 1640 | Thermo Fisher | Cat#21875034 |
| MEM Non-essential amino acids | Thermo Fisher | Cat#11140035 |
| Opti-MEM Reduced Serum Media | Thermo Fisher | Cat#31985047 |
| Saccharose | Sigma-Aldrich | Cat#S0389-500G |
| NuPAGE 4–12% Bis-Tris Gels | Invitrogen | Cat#NP0323BOX |
| Immobilon-FL PVDF membrane | Sigma-Aldrich | Cat#IPFL00010 |
| XbaI restriction enzyme | New England BioLabs | Cat#R0145 |
| MluI restriction enzyme | New England BioLabs | Cat#R0198 |
| 384-well Clear Flat Bottom Polystyrene TC-treated Microplates | Corning | Cat#3701 |
| Semi dry blot transfer buffer (10X) | Alfa Aesar | Cat#J63664 |
| NuPAGE™ MES SDS Running Buffer | Invitrogen | Cat#NP0002 |
| TransIT®-LT1 Transfection Reagent | MoBiTec | Cat# MIR2306-1mL |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.