Skip to main content
NCBI home page
Virus Research logoLink to Virus Research
. 2023 Nov 10;339:199248. doi: 10.1016/j.virusres.2023.199248

Antiviral effects of micafungin against pteropine orthoreovirus, an emerging zoonotic virus carried by bats

Eiichi Hondo a,1,⁎, Tetsufumi Katta a,1, Ayato Sato b, Naoya Kadofusa b, Tomoki Ishibashi c, Hiroshi Shimoda d, Hirokazu Katoh e, Atsuo Iida a
PMCID: PMC10665676  PMID: 37858730

Highlights

  • •

    A library of 2943 FDA-approved drugs was screened to find potential antiviral drugs of pteropine orthoreovirus.

  • •

    Six hit compounds dramatically inhibited viral replication in vitro.

  • •

    Micafungin possessed antiviral activity to multiple strains of PRV.

  • •

    Micafungin suppressed PRV release in human cells.

Keywords: Pteropine orthoreovirus, Antiviral, Fda-approved drug, Micafungin

Abstract

Bat-borne emerging zoonotic viruses cause major outbreaks, such as the Ebola virus, Nipah virus, and/or beta coronavirus. Pteropine orthoreovirus (PRV), whose spillover event occurred from fruits bats to humans, causes respiratory syndrome in humans widely in South East Asia. Repurposing approved drugs against PRV is an effective tool to confront future PRV pandemics. We screened 2,943 compounds in an FDA-approved drug library and identified eight hit compounds that reduce viral cytopathic effects on cultured Vero cells. Real-time quantitative PCR analysis revealed that six of eight hit compounds significantly inhibited PRV replication. Among them, micafungin used clinically as an antifungal drug, displayed a prominent antiviral effect on PRV. Secondly, the antiviral effects of micafungin on PRV infected human cell lines (HEK293T and A549), and their transcriptome changes by PRV infection were investigated, compared to four different bat-derived cell lines (FBKT1 (Ryukyu flying fox), DEMKT1 (Leschenault's rousette), BKT1 (Greater horseshoe bat), YUBFKT1 (Eastern bent-wing bats)). In two human cell lines, unlike bat cells that induce an IFN-γ response pathway, an endoplasmic reticulum stress response pathway was commonly activated. Additionally, micafungin inhibits viral release rather than suppressing PRV genome replication in human cells, although it was disturbed in Vero cells. The target of micafungin's action may vary depending on the animal species, but it must be useful for human purposes as a first choice of medical care.

1. Introduction

Emerging infectious diseases that have emerged in recent years and caused outbreaks worldwide pose a major threat in today's human society, where movement across borders and continents has become more accessible. The Ebola virus (Leroy et al., 2005) has repeatedly emerged mainly in West and Central Africa. Nipah virus (Chua et al., 2002) caused outbreaks in Malaysia and India. SARS-CoV (Li et al., 2005) and SARS-CoV-2 (Zhou et al., 2020) caused a pandemic. All of these viruses are considered to be of bat origin. Bats do not seem to show severe clinical symptoms when infected with these viruses, and they act as carriers of the viruses by long distant flight while infected (Middleton et al., 2007; Swanepoel et al., 1996; Watanabe et al., 2010). Bat-borne viral diseases have emerged due to indirect transmission through other wildlife or direct transmission from bats to humans (Irving et al., 2021; Wang LF and Anderson DE, 2019). Surveillance of bat viruses and the establishment of medical treatments are important to prevent damage from infectious diseases.

Pteropine orthoreovirus (PRV) is one such bat-borne virus. PRV belongs to the genus orthoreovirus, family Reoviridae. The first isolation was from flying foxes in 1968 (as Nelson Bay orthoreovirus) (Gard G and Compans RW, 1970). It was considered a virus that only bats have had for a long time. In 2006, PRV was isolated from patients with acute respiratory symptoms, and its pathogenicity in humans was confirmed (Kaw et al., 2007). Until now, PRV has been isolated from flying foxes (Pritchard et al., 2006; Takemae et al., 2018; Taniguchi et al., 2017) and patients (Cheng et al., 2009; Chua et al., 2011; Wong et al., 2012; Yamanaka et al., 2014) in Malaysia, Indonesia, and the Philippines. Most patients with PRV infection suffer from cough, sore throat, and high fever, and some develop symptoms of infectious gastroenteritis (diarrhea and vomiting) (Tan et al., 2017). A recent study reported that 13%−18% seropositivity against PRV remained from 2001 to 2017 on Tioman Island, Malaysia (Leong et al., 2022).

More attention should be paid to the genomic structure of PRV. The segmented RNA genome of PRV is the driving force for viral evolution by genetic reassortment (McDonald et al., 2016). In influenza virus with a similarly segmented RNA genome, genetic reassortment occurred in pigs, and the H1N1/2009 virus infecting humans caused a major pandemic (Smith et al., 2009). Possible genetic reassortment events among PRV strains have already been reported (Takemae et al., 2018). Therefore, PRV is an emerging infectious bat-borne virus that poses a future threat of altered pathogenicity, but no specific clinical treatment for PRV infection has yet been developed.

Drug repurposing is a practical approach to combat emerging infectious diseases. Officially approved medical drugs have well-recognized safety, require less time for approval in another usage, and are cost-effective to manufacture than new chemical drugs (Mercorelli et al., 2018). Thus, these drugs are potent in the early stages of an emerging infectious disease epidemic. During the SARS-CoV-2 pandemic, an inhibitor of the Ebola virus RNA-dependent RNA polymerase, Remdesivir (Veklury; Gilead Sciences, USA) used for the treatment (Wang et al., 2020). In this study, we performed in vitro screening using an FDA-approved drug library as a key for drug repurposing against PRV infections.

Fusogenic orthoreovirus to which PRV belongs does not have an envelope and induces rapid (approximately 8 h post-infection) syncytium formation when they infect cultured cells via a specialized nonstructural protein FAST (Ciechonska M and Duncan R, 2014). Reduced lethality of FAST-deficient PRV in mice indicates that syncytium formation is an important step for virulence (Kanai et al., 2019). In this study, we used this inhibition of syncytial formation to evaluate the drugs.

Furthermore, the anti-PRV effects of the selected compound in human cells were investigated. We distinguished between highly PRV-sensitive two human cell lines (HEK293T and A549) and a bat cell line, and less PRV-sensitive bat cell lines (Tarigan et al., 2021), comparing RNA-seq data after PRV infection.

2. Materials and methods

2.1. Cells

Vero JCRB 9013, FBKT1 (Ryukyu flying fox, P. dasymallus, kidney), DEMKT1 (Leschenault's rousette, Rousettus leschenaultii, kidney), BKT1 (Greater horseshoe bat, R. ferrumequinum, kidney), YUBFKT1 (Eastern bent-wing bats, M. fuliginosus, kidney) (Tarigan et al., 2021), and human HEK293T and A549 were used in this study. Cells were cultured in Dulbecco's Modified Eagle's Medium (DMEM; Nissui, Tokyo, Japan) containing 10% fetal bovine serum (FBS; HyClone, Logan, USA), 2% l-glutamine (Sigma, Milwaukee, Wisconsin, USA), 0.14% sodium hydrogen carbonate (NaHCO3; Sigma, Milwaukee, USA), and 100 U/mL-0.1 μg/mL penicillin-streptomycin (Meiji, Tokyo, Japan). Only Vero cells were used for selecting chemical compounds against PRV.

2.2. PRVs

The viral strains Garut-50 (PRV50G) and Garut-69 (PRV69G) that were previously isolated from greater flying fox (Pteropus vampyrus) in Indonesia (Takemae et al., 2018) were propagated in Vero cells in DMEM medium containing 2% FBS and stored at −80 °C until use. Virus titration was performed by plaque assay in Vero cells.

2.3. Chemical compounds

The 2,943 chemical compounds in the FDA-approved drug library (L1300, Selleck, Houston, USA) were used in this study. The compounds were stored at −30 °C until use. Gemcitabine (G0367, TCI, Tokyo, Japan), micafungin sodium (HY-16,321, Medchemexpress, New Jersey, USA), and chlorophyllin sodium copper salt (C2945, LKT, Minnesota, USA) were additionally purchased.

2.4. Syncytium inhibition assay

Syncytium inhibition assay was performed using PRV50G. Vero cells were seeded at a concentration of 2×104 cells/well in a 96-well plate. Each compound of the FDA-approved drug library was added to each well at a concentration of 20 µM, and two hours later, PRV50G was infected at MOI = 0.1. The cytopathic effect (CPE) was observed by light microscopy. Compounds added to wells with less CPE than the control or no CPE observed were selected.

2.5. MTT assay

MTT assay was performed to measure the cell viability of PRV50G infected Vero cells with MTT solution of MTT Cell Count Kit (Nacalai tesque, Kyoto, Japan). After two hours of reaction, the solubilizing solution was added and incubated at 37 °C overnight. The absorbance values at 595 nm and 750 nm were measured in a microplate reader. The relative cell viability was calculated as the ratio of the absorbance value of the mock group. Each experiment was triplicated.

2.6. RT-qPCR

For further validation of the anti-PRV50G effect of eight hit compounds and 3′,5′-Di-O-benzoyl-2′-deoxy-2′,2′-difluorocytidine, a prodrug of gemcitabine, qPCR was performed to quantify viral load in PRV50G infected Vero cells. Each of the nine compounds was diluted with DMSO to 2, 8, 20, and 50 µM. Each dilution or DMSO was added 1 µl to Vero cells cultured in a 96-well plate, and after two hours, PRV50G was infected at MOI = 0.01. At 24 h post-infection (hpi), the supernatant was removed, cells were washed with PBS, and used as samples for RNA extraction.

Total RNA was extracted using ISOGEN2 (Nippon gene, Tokyo, Japan). Reverse transcription reaction and qPCR reaction were performed in one step using RNA-direct SYBR Green Realtime PCR Master Mix (TOYOBO, Osaka, Japan) (90 °C for 30 s, 61 °C for 20 min, 95 °C for 30 s, 95 °C for 5 s - 55 °C for 10 s - 74 °C for 15 s for 35 cycles). The melting curve was analyzed (95 °C for 10 s, 65 °C for 60 s, and 97 °C for 1 s). Primer sequences were designed to amplify a region of the S4 segment region of PRV50G (forward,5′- TTGGATCGAATGGTGCTGCT -3′; reverse, 5′- TCGGGAGCAACACCTTTCTC -3′, amplicon size: 159 bp). A standard curve was created and obtained Ct values were plotted. The relative viral RNA copy number compared to the control was calculated as follows; The numerical values of the experimental group or the control (vehicle) were divided by the average value of the vehicle's values, for each trial of the experiment, logarithmically transformed, and then calculated to obtain the mean and standard deviation values.

2.7. ATP assay

ATP assay was performed to confirm the cytotoxicity of the six hit compounds and the gemcitabine prodrug, except for evans blue and caspofungin, which had low PRV inhibitory effects among the hit compounds. Each of the seven compounds or DMSO was added 1 µl at concentrations of 2, 8, 20, and 50 µM to Vero cells cultured in a 96-well plate. After incubation at 37 °C for 24 h, CellTiter-Glo 2.0 Cell Viability Assay solution (Promega, USA) was added. Luminescence values were measured by Infinite 200 PRO (TECAN, Switzerland). The relative cell viability was calculated as the ratio of the luminescence value of the vehicle group. Each experiment was hexaplicated.

2.8. Verification of antiviral steps

Binding/Entry/Post-entry assays were performed to validate the antiviral steps of the six hit compounds to PRV50G infection. In the Binding assay, Vero cells were preincubated at 4 °C for 30 min, PRV50G at MOI = 0.1, and each compound was added simultaneously for 90 min adsorption reaction at 4 °C. In the Entry assay, PRV50G was inoculated at MOI=0.1 after preincubation at 4 °C for 30 min, and the adsorption reaction was performed at 4 °C for 90 min. After washing in PBS twice, each drug was added and incubated at 37 °C for 90 min. In the Post-entry assay, PRV50G was inoculated at MOI = 0.01, incubated at 37 °C for 90 min, washed twice with PBS, and incubated for 24 h with each compound. In each treatment, RNA was extracted, and the relative viral copy number was calculated by RT-qPCR.

2.9. Compound effects on another strain of PRVs

To test whether micafungin inhibits another strain of PRVs at the post-entry step, we also examined its effect on PRV69G. Vero cells were seeded at a concentration of 1.5×105 cells/well in a 24-well plate, cultured in DMEM containing 2% FBS, and incubated for 24 h at 37 °C, 5% CO2. PRV50G or PRV69G were infected at MOI = 0.01 or 0.1, respectively, incubated at 37 °C for 90 min, and washed twice with PBS. DMSO or micafungin was added to each well, incubated for 24 h, and replaced with a 0.8% agarose-containing medium. After 24 or 48 h, cells were stained with crystal violet. The plaque area that was not stained was measured by ImageJ Fiji. The threshold value was set at 20–180.

2.10. RNA-seq analysis

Four types of bat-derived cell lines and two types of human cells (HEK293T cells and A549 cells) were seeded in 6-well plates at a density of 5 × 105 cells/well and cultured for 24 h in DMEM medium containing 10% FBS. The medium was then changed to DMEM medium containing 2% FBS, and the cells were infected with PRV50G at MOI=0.1. After a 2-hour adsorption period, the viral supernatant was removed, and the cells were washed twice with DMEM medium containing 2% FBS. Subsequently, fresh DMEM medium containing 2% FBS was added, and the infection time was set until cytopathic effects (CPE) were observed under an optical microscope. RNA extraction was performed using ISOGEN II (Nippon Gene, Japan) and further cleaned up using the RNeasy Mini Kit (QIAGEN, Hilden, Germany) at 24 h post-infection for bat cells and 6 h post-infection for human cells. Next-generation sequencing of the extracted RNA was outsourced to Macrogen (Kyoto, Japan).

The analysis of the raw data (fastq files) obtained in this study was performed using the supercomputer system at the National Institute of Genetics, Japan. First, quality checks and adapter trimming (-g option) were conducted using Fastp software (v.0.20.1). For mapping, the GRCh38.p13 reference genome for humans was utilized (NCBI), and gene annotation was obtained from gencode.v42.annotation.gff3 (Frankish et al., 2019) . The creation of each bat reference genome was carried out by the following procedure. Pair-end fastq files from uninfected all bat cell lines were subjected to automatic adapter removal using Peat software (default settings) (Li et al., 2015), followed by de novo assembly using Trinity software (default settings) (Grabherr et al., 2011). The Homo_sapiens.GRCh38.cdna.all.fa (human reference data) was downloaded from e!Ensembl and subjected to a similarity search using FASTA3 (parameters: -b 1 -d = 1 -E 1e-15) (Pearson WR, 1988) with the de novo assembled sequences. From the results of the similarity search (text file), gene names for humans and their corresponding query sequences were extracted, and within the extracted data, duplicate sequences were removed, retaining only one instance of gene sequence that was identical (using the Seqkit software). The unique fasta files corresponding to each species of bats used in this study as cell lines, prepared like this, were used as mapping references. Mapping of the data was conducted using HISAT2 software (v.2.1.0, default settings), followed by conversion of the SAM file to the BAM format using samtools (v.1.7) (Li et al., 2009). Read counts were obtained using featureCounts (v.2.0.0) for humans, while for bats, uniquely mapped reads were extracted using the ’NH:i:1′ flag with the Linux grep command and counted using the uniq command. Identification of differentially expressed genes was performed using the DESeq2 package (v.1.36.0) in R (v.4.2.0) (Love et al., 2014). Venn diagrams were generated using the VennDiagram package (v.1.7.3), and gene ontology (GO) analysis of upregulated genes was conducted using the clusterprofiler package (v.4.4.1) (Wu et al., 2021).

2.11. Effects of micafungin on PRV-infected human cells

To investigate the impact of Micafungin on human cells, qPCR and TCID50 assay were performed. In the TCID50 assay, human cells cultured in a 96-well plate were infected with PRV50G at an MOI of 0.1 or 0.01. After 24 h of infection, the culture supernatant was collected. The culture supernatant was serially diluted in 2% FBS + DMEM medium, and then inoculated onto Vero cells cultured in a 96-well plate. Micafungin was added 90 min post-infection, after removal of the viral solution and PBS washing. After 3 days, cytopathic effects (CPE) were observed, and the TCID50 was calculated. For RT-qPCR to quantitate viral RNA copies, the cells, but not the supernatants, were used.

2.12. Statistics

All statistical analyses were performed using the statistical software R (ver. 4.2.0). Statistical differences were calculated by the Wilcoxon rank sum test or students’ T-test. The threshold value is P < 0.05.

3. Results

3.1. Identification of hit compounds

First, primary hit compounds that inhibit the cytopathic effect (CPE) that PRV exhibits in Vero cells were identified among 2943 compounds (Fig. 1A). PRV induces syncytium formation when it infects cultured cells. The syncytium eventually dissolves as viral replication proceeds, leaving traces of the syncytium in the dish (Fig. 1B). Compounds which showed smaller syncytium formation than that of the control, or in which no syncytium formation was observed were selected. Finally, the top 8 compounds with the highest cell viability with MTT assay were selected as hit compounds (Fig. 1C).

Fig. 1.

Fig 1

Open in a new tab

Phenotypic screening identified 8 hit compounds. (A) Schematic representation of the screening. (B) Cytopathic effect (CPE) of PRV50G. Vero cells infected with PRV50G at MOI = 0.1 for 24 h. (C) List of eight hit compounds.

3.2. Inhibitory effects of hit compounds on PRV replication

The anti-PRV activity of hit compounds was verified by RT-qPCR. Vero cells which were treated with each of eight hit compounds or 3′,5′-Di-O-benzoyl-2′-deoxy-2′,2′-difluorocytidine, the gemcitabine prodrug, were infected with PRV50G. Of the nine compounds, mycophenolic acid, yangonin, brequinar, gemcitabine, gemcitabine prodrug, micafungin, and chlorophyllin decreased relative viral plaque RNA copy number less than 1×10−2 at 50 µM (Fig. 2A). The highest inhibition was observed in gemcitabine prodrug at 1×10−5.81. Mycophenolic acid, brequinar, and gemcitabine greatly inhibited PRV50G replication at a low concentration range (2 µM). Micafungin inhibited PRV50G replication in a dose-dependent manner, increasing its efficacy to levels comparable to gemcitabine (1×10−4) at 50 µM. Secondary, cell cytotoxicity of seven compounds, which exhibited high inhibition to PRV50G by RT-qPCR, was measured by ATP assay (Fig. 2B). Unlike the MTT assay, the ATP assay can eliminate the reducing properties of the compound. Without virus infection, the amount of ATP was measured 24 h after the addition of the compound, and the relative cell viability compared to the control group was calculated. Cell viability did not decrease below 75% up to 50 µM for the six compounds, mycophenolic acid, yangonin, brequinar, gemcitabine, micafungin, chlorophyllin, except gemcitabine prodrug (Fig. 2B).

Fig. 2.

Fig 2

Open in a new tab

Validation of anti-PRV effect of hit compounds. (A) Dose-dependent viral replication inhibition of hit compounds. Vero cells treated with compounds and infected at MOI = 0.01 for 24 h. The relative viral RNA copy was determined by RT-qPCR (n = 6, mean ± SE). Gemcitabine prodrug means 3′,5′-Di-O-benzoyl-2′-deoxy-2′,2′-difluorocytidine. Statistical analysis performed by package rstatix (version 0.7.0) wilcox_test function (*p < 0.05, **p < 0.01). (B) Cell cytotoxicity of hit compounds. The relative cell viability of Vero cells treated compounds for 24 h by ATP assay (n = 6, mean ± SE).

3.3. Gemcitabine, micafungin, and yangonin inhibit PRV replication at the post-entry step

The viral infection cycle was divided into three steps; binding on the host cell membrane, entry into the host cell, and post-entry. Low-temperature treatment at 4 °C for 90 min enables the virus to bind the host cell membrane but inhibits its entry into the host cell. Using this mechanism, we performed a Binding/Entry/Post-entry assay to investigate in which step compounds inhibit PRV replication (Fig. 3A). Concentrations of each compound were set at that largely inhibited PRV replication (gemcitabine, mycophenolic acid, brequinar = 2 µM, chlorophyllin, yangonin = 20 µM, micafungin = 50 µM). None of the compounds showed significant inhibition in the virus binding and entry steps (Fig. 3B). Gemcitabine, yangonin, and micafungin inhibited viral replication at the post-entry step at levels (Fig. 3B). Other compounds only reduced the relative viral copy number to 1.0×10−1.

Fig 3.

Fig 3

Open in a new tab

(A) The illustration of Binding/Entry/Post-entry assay protocol. (B) Results of RT-qPCR (n = 3, mean ± SD). The ratio of the copy number to that of the DMSO group was defined as the relative viral RNA copy.

3.4. Micafungin inhibits another strain of PRVs at the post-entry step

Based on the experiments, we focused on micafungin, which has a high repositioning advantage among the present compounds. To further expand the potential of micafungin as an anti-PRV agent, we tested its inhibitory effect on PRV69G, another strain of PRVs that we isolated in Indonesia. Micafungin significantly inhibited the replication of PRV69G and PRV50G at 50 µM (Fig. 4A and 4B).

Fig 4.

Fig 4

Open in a new tab

(A) Plaque assay of micafungin against PRV50G and PRV69G. (B) Area of plaques was calculated by ImageJ Fiji. Statistical significance was analyzed by Welch t-test (*p < 0.05, **p < 0.01, ns = not significant with 0 µM group).

3.5. RNA-seq analysis

The read count and mapping rate of each sample obtained through RNA-seq were shown in supplemental Table 1. The mapping rate indicates the proportion of uniquely mapped reads in the total read count. The mapping rate was highest in the order of human, small insectivorous bat, and fruits bat.

When four types of bat cells were infected with PRV50G at MOI = 0.1, only FBKT1 cells exhibited cellular cytopathic effects (CPE) and reduced cell viability 24 h post-infection, the same as our previous study (Tarigan et al., 2021). RNAs from the four bat cell types at 24 h post-infection were extracted, and followed by RNA-seq. Since no reference for mapping the bat genome was available in public databases, we utilized de novo assembled sequences from non-infected samples.

Among the genes that met the threshold criteria (padj < 0.05, Fold change > 2) in the virus-infected group, we identified 283 upregulated genes in BKT1, 254 in YUBFKT1, 178 in DEMKT1, and 135 in FBKT1. Among these, 26 genes showed consistent upregulation across the four bat cell types (Fig. 5A). Others were either commonly upregulated in some species or specifically upregulated in only one species (Fig. 5A). To understand the common characteristics of innate immune response in bat cells, gene ontology (GO) analysis was conducted for these 26 genes (supplemental Table 2). Significant enrichment of pathways was related to antiviral defense, such as "defense response to virus" (GO:0,051,607) (Fig. 5B). Additionally, pathways associated with the type II interferon, IFN-γ response, were strongly enriched, including "response to interferon-gamma" (GO:0,034,341), "cellular response to interferon-gamma" (GO:0,071,346), and "interferon-gamma-mediated signaling pathway" (GO:0,060,333).

Fig. 5.

Fig 5

Open in a new tab

(A) The number of upregulated genes in 4 bat cell lines. Twenty six genes are commonly upregulated. (B) Top GO terms analyzed using commonly upregulated 26 genes in (A).

RNA-seq was also conducted in human cells. Two types of human-derived cultured cells, HEK293T cells, and A549 cells, were infected with PRV50G at MOI = 0.1. Cytopathic effects (CPE) appeared six hours post-infection, and by 24 h post-infection, most cells had died, making it impossible to recover a sufficient quality of RNA. Therefore, RNA was collected at the six-hour time point and subjected to RNA-seq.

The number of upregulated genes was 1,084 in HEK293T cells and 217 in A549 cells, with only 17 genes shared between them (Fig. 6A). Gene ontology (GO) analysis of these 17 genes revealed the most significant enrichment in the pathway related to endoplasmic reticulum stress response (GO:0,034,976) (Fig. 6B). Five genes, including the endoplasmic reticulum chaperone HSPA5, PML, CALR, PPP1R15A, and SDF2L1, showed common upregulation in human cells (Supplemental Table 3). Only two were known interferon-induced genes (ISGs), namely Interferon Stimulated Exonuclease Gene 20 (ISG20) and Interferon Induced Protein 35 (IFI35) (Supplemental Table 3). To verify if the interferon response occurred in each cell type, the top 10 genes with high Fold change values among the upregulated genes in A549 cells were examined. It was found that in addition to type III interferons IFN-lambda (IFNL1, IFNL2, IFNL3), type I interferon IFN-β (IFNB1) was also included (Supplemental Table 4). On the other hand, no interferon genes were found among the top 10 genes in HEK293T cells (Supplemental Table 5). Only A549 cells exhibited induced interferon production.

Fig. 6.

Fig 6

Open in a new tab

(A) Upregulated genes by PRV infection in two human cell lines, which show high sensitivity for PRV. Seventeen commonly upregulated genes are found. (B) Top Go terms using 17 genes in (A).

Lastly, to examine the mechanisms of PRV resistance in three bat cell types (BKT1, DEMKT1, YUBFKT1) as previously reported (Tarigan et al., 2021), the overlap of upregulated genes among the five cells (with PRV sensitive FBKT1 and A549 human cells), was examined. Eighteen genes were found to be upregulated exclusively in PRV-resistant bat cells (Fig. 7A, red circle). Gene ontology analysis of these 18 genes revealed enrichment only in general GO terms, such as "defense response to virus" (GO:0,051,607) (Fig. 7B). Among the 18 genes, in addition to known ISGs such as EIF2AK2 encoding protein kinase R and IFITM2, it included PSMB9 and PSMB10 encoding immunoproteasome subunits (Supplemental Table 6).

Fig. 7.

Fig 7

Open in a new tab

(A) Unpregulated genes in PRV highly sensitive cell lines (human A549 and fruits bat FBKT cells) and three PRV-resistant cell lines (YUBKT, BKT and DEMKT cells). Eighteen common upregulated genes among all PRV-resistant cells (red circle). (B) Top GO terms using 18 genes in (A).

3.6. Micafungin inhibits PRV viral release in human cells

To investigate the antiviral effects of micafungin for future application in humans, the inhibitory effect against PRV was evaluated using human-derived HEK293T cells and A549 cells through RT-qPCR and TCID50 assays. No significant change was found in the viral copy number within the cells in both cell types (Fig. 8A). However, in HEK293T cells at 8 µM and A549 cells at 20 µM, a significant reduction in viral titer in the culture supernatant was observed (Fig. 8B).

Fig. 8.

Fig 8

Open in a new tab

The effects of micafungin for two human cell lines. (A) The number of relative viral copies infected with PRV50G to cell lines. Total RNA extraction and RT-qPCR was conducted 24 h after PRV infection (n = 3, average±SD). The ratio of the copy number to that of the DMSO group was defined as the relative RNA copy. (B) Virus titers in the culture media by TCID50 assay (n = 3, average±SD).

4. Discussion

We identified eight hit compounds among 2,943 FDA-approved drugs that showed anti-PRV activity in vitro. The screening was performed in two steps: observation of viral cytopathic effect and MTT assay to measure cell viability (Fig. 1). Dose-response analysis by RT-qPCR showed that six compounds, except evans blue and caspofungin, particularly inhibited PRV replication (Fig. 2A). Subsequent ATP assays revealed that the confirmed anti-PRV effect was not due to cell cytotoxicity (Fig. 2B). Hit compounds included mycophenolic acid, brequinar, and gemcitabine, which are already known for their inhibitory effect against rotavirus belonging to the same family Reoviridae (Fig. 1D) (Chen et al., 2020, 2019; Yin et al., 2016).

Because viruses use host nucleotides to replicate their genomes (Shatkin AJ, 1969), depletion of host nucleotide pools leads to inhibit viral replication (Hoffmann et al., 2011). Mycophenolic acid and brequinar inhibit dehydrogenases required for de novo purine/pyrimidine biosynthesis (Chen et al., 1992.; Sintchak et al., 1996). Gemcitabine, a cytidine analogue, also inhibits pyrimidine biosynthesis (Lee et al., 2017). These three drugs inhibit multiple viral replications; hence they are known as broad-spectrum antiviral agents (Andersen et al., 2020). Furthermore, there are accumulating reports that the three drugs activate some interferon-stimulated genes (ISGs), an innate immune system of the host (Li et al., 2020; Luthra et al., 2018; Pan et al., 2012; Shin et al., 2018). Here, we showed that these three drugs have inhibitory effects on PRV. The weakened effect of brequinar and mycophenolic acid was observed in the post-entry step (Fig. 3B). On the other hand, gemcitabine inhibits PRV replication at a high level in the post-entry step, which is thought to be due to its direct action on the viral polymerase (Shin et al., 2018). These results raise the possibility of repositioning gemcitabine against PRV, that currently widely used as an anticancer agent. In this study, gemcitabine inhibits PRV replication at the point of 2 µM, which is consistent with previous results with rotavirus (Chen et al., 2020). In murine leukemia virus (Clouser et al., 2011), HIV-1 (Clouser et al., 2012), and human rhinovirus (Song et al., 2017), studies showed that antiviral activity of gemcitabine in vivo achieved at doses significantly lower than those given as an anticancer agent. However, because strong side effects of gemcitabine, such as myelosuppression, may be considered more severe than symptoms of PRV infection at present, careful consideration should be given to repositioning (Abbruzzese et al., 1991).

Yangonin is an extract of the kava plant, and chlorophyllin sodium copper salt (CHL) is a semi-synthetic compound derived from the naturally-occurring green pigment chlorophyll and used as a food additive (Clouatre DL, 2004; Tumolo T and Lanfer-Marquez UM, 2012). Antiviral effects on yangonin and CHL have been reported in several RNA viruses (Li et al., 2017; Liu et al., 2020). However, the clinical use of yangonin has been restricted due to its hepatotoxicity (Clouatre DL, 2004). CHL has been reported to inhibit virus entry into host cells in enterovirus 71, coxsackievirus (Liu et al., 2020). The inhibition mechanism was not dealt with in this study.

Micafungin and caspofungin are echinocandins that specifically inhibit 1,3-β-glucan synthase, which synthesizes the fungal cell wall (Odds et al., 2003). Recently, the antiviral activity of micafungin and its analogues, caspofungin, and anidulafungin, have been reported in enterovirus 71 (Kim et al., 2016), chikungunya virus (Ho et al., 2018), dengue virus (Chen et al., 2021), zika virus (Lu et al., 2021), SARS-CoV-2 (Ku et al., 2020). The fact that these antifungals are already in use, and have known few side effects, is an advantage in repositioning (Cheng et al., 2022). Micafungin and caspofungin were identified as hit compounds in this screening, but micafungin was more effective in inhibiting PRV replication in Vero cells. Plaque assay revealed that micafungin inhibits another strain of PRVs, PRV69G. Phylogenetic analysis suggests that reassortment events occurred among various strains of PRVs (Takemae et al., 2018). In mammalian orthoreovirus, frequent reassortment events have been reported in bats (Lelli et al., 2015; Naglič et al., 2018). The broad anti-PRV activity of micafungin might be effective against new reassortants that may emerge in the future.

Among the 26 genes that were commonly upregulated in the four bat cell lines (Supplemental Table 2), RIG-I (DDX58) and LGP2 (DHX58), members of the RIG-I-like receptor family, recognize viral-derived double-stranded RNA and induce the production of type I interferons (Kato et al., 2008). Interferon regulatory factors IRF1 and IRF7 also induce the production of type I interferons (Andrilenas et al., 2018; Pine et al., 1990). Therefore, it is expected that the production and response of type I interferons occur in the four bat cell types. Gene ontology analysis suggested the induction of the IFN-γ response pathway (Fig. 5B). This type of IFN-γ response has been reported to be induced by poly I:C stimulation, a double-stranded RNA analog, in two Eptesicus bat cell species, suggesting it may be a conserved innate immune mechanism in bats (Lin et al., 2022).

In human cells, specifically HEK293T cells, the expression of interferon genes could not be detected. This may be due to differences in cellular properties rather than organ-specific differences. Previous studies have shown that HEK293T cells exhibit low responsiveness to IFN-α treatment (De La Cruz-Rivera PC et al., 2018). Also, it has been reported that HEK293T cells do not express TLR3, one of the pattern recognition receptors (de Bouteiller O, 2005). Therefore, it is considered that HEK293T cells have low responsiveness to viral infections. In A549 cells, the expression of not only IFN-β but also type III interferon, IFN-lambda, was strongly induced, followed by the induction of ISGs (Interferon-Stimulated Genes). In the two human cell types where a rapid decrease in cell viability was observed, the unfolded protein response (UPR) pathway was strongly induced (Fig. 6B). UPR is a cellular response that alleviates endoplasmic reticulum stress caused by the accumulation of abnormal proteins in the endoplasmic reticulum (Xu et al., 2005). HSPA5 (also known as Bip or GRP78), which showed increased expression in human cells in this study, encodes an endoplasmic reticulum chaperone and is known as a marker gene induced in the early stages of the unfolded protein response (Zhang et al., 2010). In cells that cannot cope with excessive or sustained endoplasmic reticulum stress induced by UPR, apoptosis is eventually induced (Xu et al., 2005). For example, in hepatitis C virus infection, UPR and subsequent apoptosis are known to be exploited by the virus for replication (Benali-Furet et al., 2005). Induction of apoptosis has also been reported in avian orthoreovirus (ARV), a virus closely related to PRV (Lin et al., 2015). In contrast, in bat cells, genes with known apoptosis inhibitory functions such as IFI6 and XAF1 were commonly upregulated (Qi et al., 2015; Jeong et al., 2018). Therefore, it is speculated that apoptosis induced by PRV is closely involved in the rapid decrease in cell viability observed in human cells.

Among the genes that were upregulated exclusively in PRV-resistant cells, PSMB9 and PSMB10, which encode the immunoproteasome subunits 20S, were included (Supplemental Table 6). The immunoproteasome is a complex consisting of multiple proteases and is induced by inflammatory cytokine stimulation such as IFN-γ and TNF-α (Ferrington DA et al., 2012). The immunoproteasome is known to degrade viral proteins within cells and maintain cellular homeostasis (McCarthy MK et al., 2015), suggesting that the immunoproteasome plays an important role in PRV-resistant bat cells.

Micafungin strongly inhibited virus release in human cells but did not inhibit viral genome replication (Fig. 8). In Vero cells, inhibition of viral genome replication was observed, indicating species differences in the antiviral action of micafungin. Not only PRV, but also various viruses known to induce endoplasmic reticulum (ER) stress in host cells, have been reported (Li et al., 2015). The finding that micafungin potentially alleviates ER stress in human cells infected with PRV, either directly or indirectly, is significant as it mitigates cell death.

Declaration of Competing Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Footnotes

Supplementary material associated with this article can be found, in the online version, at doi:10.1016/j.virusres.2023.199248.

Appendix. Supplementary materials

mmc1.docx (69.4KB, docx)

Data availability

  • No data was used for the research described in the article.

References

  1. Abbruzzese, J.L., Grunewald, R., Weeks, E.A., Gravel, D., Adams, T., Nowak, B., Mineishi, S., Tarassoff, P., Satterlee, W., Raber, M.N., Plunkett, W., 1991. A phase I clinical, plasma, and cellular pharmacology study of gemcitabine. 9, 491–498. 10.1200/JCO.1991.9.3.491. [DOI] [PubMed]
  2. Andersen P.I., Ianevski A., Lysvand H., Vitkauskiene A., Oksenych V., Bjørås M., Telling K., Lutsar I., Dumpis U., Irie Y., Tenson T., Kantele A., Kainov D.E. Discovery and development of safe-in-man broad-spectrum antiviral agents. Int. J. Infect. Dis. 2020;93:268–276. doi: 10.1016/J.IJID.2020.02.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Andrilenas K.K., Ramlall V., Kurland J., Leung B., Harbaugh A.G., Siggers T. DNA-binding landscape of IRF3, IRF5 and IRF7 dimers: implications for dimer-specific gene regulation. Nucleic Acids Res. 2018;46(5):2509–2520. doi: 10.1093/nar/gky002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Benali-Furet N.L., Chami M., Houel L., De Giorgi F., Vernejoul F., Lagorce D., Buscail L., Bartenschlager R., Ichas F., Rizzuto R., Paterlini-Bréchot P. Hepatitis C virus core triggers apoptosis in liver cells by inducing ER stress and ER calcium depletion. Oncogene. 2005;24(31):4921–4933. doi: 10.1038/sj.onc.1208673. [DOI] [PubMed] [Google Scholar]
  5. Chen S.-F., Perrella F.W., Behrens D.L., Papp L.M. Inhibition of dihydroorotate dehydrogenase activity by brequinar sodium. CANCER Res. 1992;52:1521–3527. [PubMed] [Google Scholar]
  6. Chen S., Ding S., Yin Y., Xu L., Li P., Peppelenbosch M.P., Pan Q., Wang W. Suppression of pyrimidine biosynthesis by targeting DHODH enzyme robustly inhibits rotavirus replication. Antiviral Res. 2019;167:35–44. doi: 10.1016/J.ANTIVIRAL.2019.04.005. [DOI] [PubMed] [Google Scholar]
  7. Chen S., Wang Y., Li P., Yin Y., Bijvelds M.J., de Jonge H.R., Peppelenbosch M.P., Kainov D.E., Pan Q. Drug screening identifies gemcitabine inhibiting rotavirus through alteration of pyrimidine nucleotide synthesis pathway. Antiviral Res. 2020;180 doi: 10.1016/J.ANTIVIRAL.2020.104823. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Chen, Y.-C., Lu, J.-W., Yeh, C.-T., Lin, T.-Y., Liu, F.-C., Ho, Y.-J., Chen, C., Lu, Y.-C., Yeh, J.-W., Lin, C.-T., Liu, T.-Y., Ho, F.-C., Carlos Saiz, J., 2021. Micafungin inhibits dengue virus infection through the disruption of virus binding, entry, and stability. 10.3390/ph14040338. [DOI] [PMC free article] [PubMed]
  9. Cheng L.W., Land K., De Vita D., Schloer S., Goretzko J., Rescher U. Repurposing antifungals for host-directed antiviral therapy? Pharm. 2022. 2022;15:212. doi: 10.3390/PH15020212. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Cheng P., Lau C.S., Lai A., Ho E., Leung P., Chan F., Wong A., Lim W. A novel reovirus isolated from a patient with acute respiratory disease. J. Clin. Virol. 2009;45:79–80. doi: 10.1016/J.JCV.2009.03.001. [DOI] [PubMed] [Google Scholar]
  11. Chua K.B., Lek Koh C., Hooi P.S., Wee K.F., Khong J.H., Chua B.H., Chan Y.P., Lim M.E., Lam S.K. Isolation of Nipah virus from Malaysian Island flying-foxes. Microbes Infect. 2002;4:145–151. doi: 10.1016/S1286-4579(01)01522-2. [DOI] [PubMed] [Google Scholar]
  12. Chua K.B., Voon K., Yu M., Keniscope C., Abdul Rasid K., Wang L.F. Investigation of a potential zoonotic transmission of orthoreovirus associated with acute influenza-like illness in an adult patient. PLoS ONE. 2011;6:e25434. doi: 10.1371/JOURNAL.PONE.0025434. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Ciechonska M., Duncan R. Reovirus FAST proteins: virus-encoded cellular fusogens. Trends Microbiol. 2014;22:715–724. doi: 10.1016/J.TIM.2014.08.005. [DOI] [PubMed] [Google Scholar]
  14. Clouatre D.L. Kava kava: examining new reports of toxicity. Toxicol. Lett. 2004;150:85–96. doi: 10.1016/J.TOXLET.2003.07.005. [DOI] [PubMed] [Google Scholar]
  15. Clouser C.L., Holtz C.M., Mullett M., Crankshaw D.L., Briggs J.E., Chauhan J., Vanhoutan I.M., Patterson S.E., Mansky L.M. Analysis of the Ex Vivo and In Vivo antiretroviral activity of gemcitabine. PLoS ONE. 2011;6:e15840. doi: 10.1371/JOURNAL.PONE.0015840. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Clouser C.L., Holtz C.M., Mullett M., Crankshaw D.L., Briggs J.E., O'Sullivan M.G., Patterson S.E., Mansky L.M. Activity of a novel combined antiretroviral therapy of gemcitabine and decitabine in a mouse model for HIV-1. Antimicrob. Agents Chemother. 2012;56:1942–1948. doi: 10.1128/AAC.06161-11/ASSET/BA1FD299-4B57-450D-B89A-327F598E2499/ASSETS/GRAPHIC/ZAC9991007310004.JPEG. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. de Bouteiller O., Merck E., Hasan U.A., Hubac S., Benguigui B., Trinchieri G., Bates E.E., Caux C. Recognition of double-stranded RNA by human toll-like receptor 3 and downstream receptor signaling requires multimerization and an acidic pH. J. Biol. Chem. 2005;280(46):38133–38145. doi: 10.1074/jbc.M507163200. [DOI] [PubMed] [Google Scholar]
  18. De La Cruz-Rivera P.C., Kanchwala M., Liang H., Kumar A., Wang L.F., Xing C., Schoggins J.W. The IFN response in bats displays distinctive IFN-stimulated gene expression kinetics with atypical RNASEL induction. J. Immunol. 2018;200(1):209–217. doi: 10.4049/jimmunol.1701214. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Ferrington D.A., Gregerson D.S. Immunoproteasomes: structure, function, and antigen presentation. Prog. Mol. Biol. Transl. Sci. 2012;109:75–112. doi: 10.1016/B978-0-12-397863-9.00003-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Frankish A., Diekhans M., Ferreira A.M., Johnson R., Jungreis I., Loveland J., Mudge J.M., Sisu C., Wright J., Armstrong J., Barnes I., Berry A., Bignell A., Carbonell Sala S., Chrast J., Cunningham F., Di Domenico T., Donaldson S., Fiddes I.T., García Girón C., Gonzalez J.M., Grego T., Hardy M., Hourlier T., Hunt T., Izuogu O.G., Lagarde J., Martin F.J., Martínez L., Mohanan S., Muir P., Navarro F.C.P., Parker A., Pei B., Pozo F., Ruffier M., Schmitt B.M., Stapleton E., Suner M.M., Sycheva I., Uszczynska-Ratajczak B., Xu J., Yates A., Zerbino D., Zhang Y., Aken B., Choudhary J.S., Gerstein M., Guigó R., Hubbard T.J.P., Kellis M., Paten B., Reymond A., Tress M.L., Flicek P. GENCODE reference annotation for the human and mouse genomes. Nucleic. Acids. Res. 2019;47(D1):D766–D773. doi: 10.1093/nar/gky955. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Grabherr M.G., Haas B.J., Yassour M., Levin J.Z., Thompson D.A., Amit I., Adiconis X., Fan L., Raychowdhury R., Zeng Q., Chen Z., Mauceli E., Hacohen N., Gnirke A., Rhind N., di Palma F., Birren B.W., Nusbaum C., Lindblad-Toh K., Friedman N., Regev A. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat. Biotechnol. 2011;29(7):644–652. doi: 10.1038/nbt.1883. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Gard G., Compans R.W. Structure and cytopathic effects of nelson bay virus. J. Virol. 1970;6:100–106. doi: 10.1128/jvi.6.1.100-106.1970. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Ho Y.J., Liu F.C., Yeh C.T., Yang C.M., Lin C.C., Lin T.Y., Hsieh P.S., Hu M.K., Gong Z., Lu J.W. Micafungin is a novel anti-viral agent of chikungunya virus through multiple mechanisms. Antiviral Res. 2018;159:134–142. doi: 10.1016/J.ANTIVIRAL.2018.10.005. [DOI] [PubMed] [Google Scholar]
  24. Hoffmann H.H., Kunz A., Simon V.A., Palese P., Shaw M.L. Broad-spectrum antiviral that interferes with de novo pyrimidine biosynthesis. Proc. Natl. Acad. Sci. U. S. A. 2011;108:5777–5782. doi: 10.1073/PNAS.1101143108/SUPPL_FILE/PNAS.201101143SI.PDF. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Irving A.T., Ahn M., Goh G., Anderson D.E., Wang L.F. Lessons from the host defences of bats, a unique viral reservoir. Nat. 2021 5897842. 2021;589:363–370. doi: 10.1038/s41586-020-03128-0. [DOI] [PubMed] [Google Scholar]
  26. Jeong S.I., Kim J.W., Ko K.P., Ryu B.K., Lee M.G., Kim H.J., Chi S.G. XAF1 forms a positive feedback loop with IRF-1 to drive apoptotic stress response and suppress tumorigenesis. Cell Death. Dis. 2018;9(8):806. doi: 10.1038/s41419-018-0867-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Kanai Y., Kawagishi T., Sakai Y., Nouda R., Shimojima M., Saijo M., Matsuura Y., Kobayashi T. Cell-cell fusion induced by reovirus FAST proteins enhances replication and pathogenicity of non-enveloped dsRNA viruses. PLoS Pathog. 2019;15 doi: 10.1371/journal.ppat.1007675. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Kato H., Takeuchi O., Mikamo-Satoh E., Hirai R., Kawai T., Matsushita K., Hiiragi A., Dermody T.S., Fujita T., Akira S. Length-dependent recognition of double-stranded ribonucleic acids by retinoic acid-inducible gene-I and melanoma differentiation-associated gene 5. J. Exp. Med. 2008;205(7):1601–1610. doi: 10.1084/jem.20080091. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Kaw B.C., Crameri G., Hyatt A., Yu M., Tompang M.R., Rosli J., McEachern J., Crameri S., Kumarasamy V., Eaton B.T., Wang L.F. A previously unknown reovirus of bat origin is associated with an acute respiratory disease in humans. Proc. Natl. Acad. Sci. U. S. A. 2007;104:11424–11429. doi: 10.1073/pnas.0701372104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Kim C., Kang H., Kim D.E., Song J.H., Choi M., Kang M., Lee K., Kim H.S., Shin J.S., Jeong H., Jung S., Han S.B., Kim J.H., Ko H.J., Lee C.K., Kim M., Cho S. Antiviral activity of micafungin against enterovirus 71. Virol. J. 2016;13:1–9. doi: 10.1186/S12985-016-0557-8/FIGURES/5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Ku K.B., Shin H.J., Kim H.S., Kim B.T., Kim S.J., Kim C. Repurposing Screens of FDA-Approved Drugs Identify 29 Inhibitors of SARS-CoV-2. J. Microbiol. Biotechnol. 2020;30:1843–1853. doi: 10.4014/JMB.2009.09009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Lee K., Kim D.-E., Jang K.-S., Kim S.-J., Cho S., Kim C., Lee K., Kim D.-E., Jang K.-S., Kim S.-J., Cho S., Kim C. Gemcitabine, a broad-spectrum antiviral drug, suppresses enterovirus infections through innate immunity induced by the inhibition of pyrimidine biosynthesis and nucleotide depletion. Oncotarget. 2017;8:115315–115325. doi: 10.18632/ONCOTARGET.23258. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Lelli D., Moreno A., Steyer A., Naglič T., Chiapponi C., Prosperi A., Faccin F., Sozzi E., Lavazza A. Detection and characterization of a novel reassortant mammalian orthoreovirus in bats in Europe. Viruses 2015. 2015;7:5844–5854. doi: 10.3390/V7112908. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Leong W.J., Quek X.F., Tan H.Y., Wong K.M., Muhammad H.S., Mohamed N.A., Wong S.T., Abdullah M.L., Leong P.P., Wang L., Voon K. Seroprevalence of Pteropine orthoreovirus in humans remain similar after nearly two decades (2001–2002 vs. 2017) in Tioman Island, Malaysia. J. Med. Virol. 2022;94:771–775. doi: 10.1002/JMV.27422. [DOI] [PubMed] [Google Scholar]
  35. Leroy E.M., Kumulungui B., Pourrut X., Rouquet P., Hassanin A., Yaba P., Délicat A., Paweska J.T., Gonzalez J.P., Swanepoel R. Fruit bats as reservoirs of Ebola virus. Nat. 2005 4387068. 2005;438:575–576. doi: 10.1038/438575a. [DOI] [PubMed] [Google Scholar]
  36. Li G., Gao Q., Yuan S., Wang L., Altmeyer R., Lan K., Yin F., Zou G. Characterization of three small molecule inhibitors of enterovirus 71 identified from screening of a library of natural products. Antiviral Res. 2017;143:85–96. doi: 10.1016/J.ANTIVIRAL.2017.04.006. [DOI] [PubMed] [Google Scholar]
  37. Li H., Handsaker B., Wysoker A., Fennell T., Ruan J., Homer N., Marth G., Abecasis G., Durbin R. 1000 Genome Project Data Processing Subgroup. The Sequence Alignment/Map format and SAMtools. Bioinformatics. 2009;25(16):2078–2079. doi: 10.1093/bioinformatics/btp352. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Li S., Kong L., Yu X. The expanding roles of endoplasmic reticulum stress in virus replication and pathogenesis. Crit. Rev. Microbiol. 2015;41(2):150–164. doi: 10.3109/1040841X.2013.813899. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Li W., Shi Z., Yu M., Ren W., Smith C., Epstein J.H., Wang H., Crameri G., Hu Z., Zhang H., Zhang J., McEachern J., Field H., Daszak P., Eaton B.T., Zhang S., Wang L.F. Bats are natural reservoirs of SARS-like coronaviruses. Science (80-.) 2005;310:676–679. doi: 10.1126/SCIENCE.1118391/SUPPL_FILE/LI-SOM.PDF. [DOI] [PubMed] [Google Scholar]
  40. Li Y.L., Weng J.C., Hsiao C.C., Chou M.T., Tseng C.W., Hung J.H. PEAT: an intelligent and efficient paired-end sequencing adapter trimming algorithm. BMC Bioinformatics. 2015;16(Suppl 1):S2. doi: 10.1186/1471-2105-16-S1-S2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Li Yunlong, Li P., Li Yang, Zhang R., Yu P., Ma Z., Kainov D.E., de Man R.A., Peppelenbosch M.P., Pan Q. Drug screening identified gemcitabine inhibiting hepatitis E virus by inducing interferon-like response via activation of STAT1 phosphorylation. Antiviral Res. 2020;184 doi: 10.1016/J.ANTIVIRAL.2020.104967]. [DOI] [PubMed] [Google Scholar]
  42. Lin H.H., Horie M., Tomonaga K. A comprehensive profiling of innate immune responses in Eptesicus bat cells. Microbiol. Immunol. 2022;66(3):97–112. doi: 10.1111/1348-0421.12952. [DOI] [PubMed] [Google Scholar]
  43. Lin P.Y., Liu H.J., Chang C.D., Chen Y.C., Chang C.I., Shih W.L. Avian reovirus S1133-induced apoptosis is associated with Bip/GRP79-mediated Bim translocation to the endoplasmic reticulum. Apoptosis. 2015;20(4):481–490. doi: 10.1007/s10495-015-1085-5. [DOI] [PubMed] [Google Scholar]
  44. Liu Z., Xia S., Wang X., Lan Q., Li P., Xu W., Wang Q., Lu L., Jiang S. Sodium copper chlorophyllin is highly effective against enterovirus (EV) A71 infection by blocking its entry into the host cell. ACS Infect. Dis. 2020;6:882–890. doi: 10.1021/ACSINFECDIS.0C00096/SUPPL_FILE/ID0C00096_SI_001.PDF. [DOI] [PubMed] [Google Scholar]
  45. Love M.I., Huber W., Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15(12):550. doi: 10.1186/s13059-014-0550-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Lu J.W., Chen Y.C., Huang C.K., Lin K.C., Ho Y.J. Synergistic in-vitro antiviral effects of combination treatment using anidulafungin and T-1105 against Zika virus infection. Antiviral Res. 2021;195 doi: 10.1016/J.ANTIVIRAL.2021.105188. [DOI] [PubMed] [Google Scholar]
  47. Luthra P., Naidoo J., Pietzsch C.A., De S., Khadka S., Anantpadma M., Williams C.G., Edwards M.R., Davey R.A., Bukreyev A., Ready J.M., Basler C.F. Inhibiting pyrimidine biosynthesis impairs Ebola virus replication through depletion of nucleoside pools and activation of innate immune responses. Antiviral Res. 2018;158:288–302. doi: 10.1016/J.ANTIVIRAL.2018.08.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. McCarthy M.K., Weinberg J.B. The immunoproteasome and viral infection: a complex regulator of inflammation. Front. Microbiol. 2015;6:21. doi: 10.3389/fmicb.2015.00021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. McDonald S.M., Nelson M.I., Turner P.E., Patton J.T. Reassortment in segmented RNA viruses: mechanisms and outcomes. Nat. Publ. Gr. 2016 doi: 10.1038/nrmicro.2016.46. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Mercorelli B., Palù G., Loregian A. Drug repurposing for viral infectious diseases: how far are we? Trends Microbiol. 2018 doi: 10.1016/j.tim.2018.04.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Middleton D.J., Morrissy C.J., van der Heide B.M., Russell G.M., Braun M.A., Westbury H.A., Halpin K., Daniels P.W. Experimental Nipah Virus Infection in Pteropid Bats (Pteropus poliocephalus) J. Comp. Pathol. 2007;136:266–272. doi: 10.1016/J.JCPA.2007.03.002. [DOI] [PubMed] [Google Scholar]
  52. Naglič T., Rihtarič D., Hostnik P., Toplak N., Koren S., Kuhar U., Jamnikar-Ciglenečki U., Kutnjak D., Steyer A. Identification of novel reassortant mammalian orthoreoviruses from bats in Slovenia. BMC Vet. Res. 2018;14:1–10. doi: 10.1186/S12917-018-1585-Y/FIGURES/1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Odds F.C., Brown A.J.P., Gow N.A.R. Antifungal agents: mechanisms of action. Trends Microbiol. 2003;11:272–279. doi: 10.1016/S0966-842X(03)00117-3. [DOI] [PubMed] [Google Scholar]
  54. Pan Q., De Ruiter P.E., Metselaar H.J., Kwekkeboom J., De Jonge J., Tilanus H.W., Janssen H.L.A., Van Der Laan L.J.W. Mycophenolic acid augments interferon-stimulated gene expression and inhibits hepatitis C virus infection InVitro and InVivo. Hepatology. 2012;55:1673–1683. doi: 10.1002/hep.25562. [DOI] [PubMed] [Google Scholar]
  55. Pearson W.R., Lipman D.J. Improved tools for biological sequence comparison. Proc. Natl. Acad. Sci. U. S. A. 1988;85(8):2444–2448. doi: 10.1073/pnas.85.8.2444. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Pine R., Decker T., Kessler D.S., Levy D.E., Darnell J.E., Jr. Purification and cloning of interferon-stimulated gene factor 2 (ISGF2): ISGF2 (IRF-1) can bind to the promoters of both beta interferon- and interferon-stimulated genes but is not a primary transcriptional activator of either. Mol. Cell. Biol. 1990;10(6):2448–2457. doi: 10.1128/mcb.10.6.2448-2457.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Pritchard L.I., Chua K.B., Cummins D., Hyatt A., Crameri G., Eaton B.T., Wang L.-F. Pulau virus; a new member of the Nelson Bay orthoreovirus species isolated from fruit bats in Malaysia. Arch. Virol. 2006;151:229–239. doi: 10.1007/s00705-005-0644-4. [DOI] [PubMed] [Google Scholar]
  58. Qi Y., Li Y., Zhang Y., Zhang L., Wang Z., Zhang X., Gui L., Huang J. Correction: IFI6 inhibits apoptosis via mitochondrial-dependent pathway in dengue virus 2 infected vascular endothelial cells. PLoS ONE. 2015;10(9) doi: 10.1371/journal.pone.0138896. Erratum for: PLoS One. 2015;10(8):e0132743. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Shatkin A.J. Replication of reovirus. Adv. Virus Res. 1969;14:63–87. doi: 10.1016/S0065-3527(08)60557-6. [DOI] [PubMed] [Google Scholar]
  60. Shin H.J., Kim C., Cho S. Gemcitabine and Nucleos(t)ide synthesis inhibitors are broad-spectrum antiviral drugs that activate innate immunity. Viruses 2018. 2018;10:211. doi: 10.3390/V10040211. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Sintchak M.D., Fleming M.A., Futer O., Raybuck S.A., Chambers S.P., Caron P.R., Murcko M.A., Wilson K.P. Structure and mechanism of inosine monophosphate dehydrogenase in complex with the immunosuppressant mycophenolic acid. Cell. 1996;85:921–930. doi: 10.1016/S0092-8674(00)81275-1. [DOI] [PubMed] [Google Scholar]
  62. Smith G.J.D., Vijaykrishna D., Bahl J., Lycett S.J., Worobey M., Pybus O.G., Ma S.K., Cheung C.L., Raghwani J., Bhatt S., Peiris J.S.M., Guan Y., Rambaut A. Origins and evolutionary genomics of the 2009 swine-origin H1N1 influenza a epidemic. NatureNature. 2009;459:1122–1125. doi: 10.1038/nature08182. [DOI] [PubMed] [Google Scholar]
  63. Song J.H., Kim S.R., Heo E.Y., Lee J.Y., Kim D.eun, Cho S., Chang S.Y., Yoon B.Il, Seong J., Ko H.J. Antiviral activity of gemcitabine against human rhinovirus in vitro and in vivo. Antiviral Res. 2017;145:6–13. doi: 10.1016/J.ANTIVIRAL.2017.07.003. [DOI] [PubMed] [Google Scholar]
  64. Swanepoel R., Leman P.A., Burt F.J., Zachariades N.A., Braack L.E.O., Ksiazek T.G., Rollin P.E., Zaki S.R., Peters C.J. Experimental inoculation of plants and animals with Ebola virus. Emerg. Infect. Dis. 1996;2:321. doi: 10.3201/EID0204.960407. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Takemae H., Basri C., Luh Putu Ika Mayasari N., Tarigan R., Shimoda H., Omatsu T., Pramono D., Dwi Cahyadi D., Kobayashi R., Iida K., Mizutani T., Maeda K., Agungpriyono S., Hondo E. Isolation of Pteropine orthoreovirus from Pteropus vampyrus in Garut. Indonesia. 2018;54:823–827. doi: 10.1007/s11262-018-1603-y. [DOI] [PubMed] [Google Scholar]
  66. Tan Y.F., Teng C.L., Chua K.B., Voon K. Pteropine orthoreovirus: an important emerging virus causing infectious disease in the tropics? J. Infect. Dev. Ctries. 2017 doi: 10.3855/jidc.9112. [DOI] [PubMed] [Google Scholar]
  67. Taniguchi S., Maeda K., Horimoto T., Masangkay J.S., Puentespina R., Alvarez J., Eres E., Cosico E., Nagata N., Egawa K., Singh H., Fukuma A., Yoshikawa T., Tani H., Fukushi S., Tsuchiaka S., Omatsu T., Mizutani T., Une Y., Yoshikawa Y., Shimojima M., Saijo M., Kyuwa S. First isolation and characterization of pteropine orthoreoviruses in fruit bats in the Philippines. Arch. Virol. 2017;162:1529–1539. doi: 10.1007/s00705-017-3251-2. [DOI] [PubMed] [Google Scholar]
  68. Tarigan R., Katta T., Takemae H., Shimoda H., Maeda K., Iida A., Hondo E. Distinct interferon response in bat and other mammalian cell lines infected with Pteropine orthoreovirus. Virus Genes. 2021;57(6):510–520. doi: 10.1007/s11262-021-01865-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Tumolo T., Lanfer-Marquez U.M. Copper chlorophyllin: a food colorant with bioactive properties? Food Res. Int. 2012;46:451–459. doi: 10.1016/J.FOODRES.2011.10.031. [DOI] [Google Scholar]
  70. Wang L.F., Anderson D.E. Viruses in bats and potential spillover to animals and humans. Curr. Opin. Virol. 2019 doi: 10.1016/j.coviro.2018.12.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  71. Wang M., Cao R., Zhang L., Yang X., Liu J., Xu M., Shi Z., Hu Z., Zhong W., Xiao G. Remdesivir and chloroquine effectively inhibit the recently emerged novel coronavirus (2019-nCoV) in vitro. Cell Res. 2020;30:269–271. doi: 10.1038/S41422-020-0282-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  72. Watanabe S., Masangkay J.S., Nagata N., Morikawa S., Mizutani T., Fukushi S., Alviola P., Omatsu T., Ueda N., Iha K., Taniguchi S., Fujii H., Tsuda S., Endoh M., Kato K., Tohya Y., Kyuwa S., Yoshikawa Y., Akashi H. Bat Coronaviruses and Experimental Infection of Bats, the Philippines. Emerg. Infect. Dis. 2010;16:1217. doi: 10.3201/EID1608.100208. [DOI] [PMC free article] [PubMed] [Google Scholar]
  73. Wong A.H., Cheng P.K.C., Lai M.Y.Y., Leung P.C.K., Wong K.K.Y., Lee W.Y., Lim W.W.L. Virulence Potential of Fusogenic Orthoreoviruses. Emerg. Infect. Dis. 2012;18:944. doi: 10.3201/EID1806.111688. [DOI] [PMC free article] [PubMed] [Google Scholar]
  74. Wu T., Hu E., Xu S., Chen M., Guo P., Dai Z., Feng T., Zhou L., Tang W., Zhan L., Fu X., Liu S., Bo X., Yu G. clusterProfiler 4.0: a universal enrichment tool for interpreting omics data. Innovation (Camb) 2021;2(3) doi: 10.1016/j.xinn.2021.100141. [DOI] [PMC free article] [PubMed] [Google Scholar]
  75. Xu C., Bailly-Maitre B., Reed J.C. Endoplasmic reticulum stress: cell life and death decisions. J. Clin. Invest. 2005;115(10):2656–2664. doi: 10.1172/JCI26373. [DOI] [PMC free article] [PubMed] [Google Scholar]
  76. Yamanaka A., Iwakiri A., Yoshikawa T., Sakai K., Singh H., Himeji D., Kikuchi I., Ueda A., Yamamoto S., Miura M., Shioyama Y., Kawano K., Nagaishi T., Saito M., Minomo M., Iwamoto N., Hidaka Y., Sohma H., Kobayashi T., Kanai Y., Kawagishi T., Nagata N., Fukushi S., Mizutani T., Tani H., Taniguchi S., Fukuma A., Shimojima M., Kurane I., Kageyama T., Odagiri T., Saijo M., Morikawa S. Imported case of acute respiratory tract infection associated with a member of species nelson bay orthoreovirus. PLoS ONE. 2014;9:e92777. doi: 10.1371/JOURNAL.PONE.0092777. [DOI] [PMC free article] [PubMed] [Google Scholar]
  77. Yin Y., Wang Y., Dang W., Xu L., Su J., Zhou X., Wang W., Felczak K., van der Laan L.J.W., Pankiewicz K.W., van der Eijk A.A., Bijvelds M., Sprengers D., de Jonge H., Koopmans M.P.G., Metselaar H.J., Peppelenbosch M.P., Pan Q. Mycophenolic acid potently inhibits rotavirus infection with a high barrier to resistance development. Antiviral Res. 2016;133:41–49. doi: 10.1016/J.ANTIVIRAL.2016.07.017. [DOI] [PubMed] [Google Scholar]
  78. Zhang Y., Liu R., Ni M., Gill P., Lee A.S. Cell surface relocalization of the endoplasmic reticulum chaperone and unfolded protein response regulator GRP78/BiP. J. Biol. Chem. 2010;285(20):15065–15075. doi: 10.1074/jbc.M109.087445. [DOI] [PMC free article] [PubMed] [Google Scholar]
  79. Zhou P., Yang X.Lou, Wang X.G., Hu B., Zhang L., Zhang W., Si H.R., Zhu Y., Li B., Huang C.L., Chen H.D., Chen J., Luo Y., Guo H., Jiang R.Di, Liu M.Q., Chen Y., Shen X.R., Wang X., Zheng X.S., Zhao K., Chen Q.J., Deng F., Liu L.L., Yan B., Zhan F.X., Wang Y.Y., Xiao G.F., Shi Z.L. A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nat. 2020 5797798. 2020;579:270–273. doi: 10.1038/s41586-020-2012-7. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

mmc1.docx (69.4KB, docx)

Data Availability Statement

  • No data was used for the research described in the article.

Articles from Virus Research are provided here courtesy of Elsevier

RESOURCES