REAGENT or RESOURCE | SOURCE | IDENTIFIER |
---|---|---|
Experimental models: Cell lines | ||
ID8 | MilliporeSigma | Cat. No. # SCC145; RRID: CVCL_IU14 |
OVCAR8 | NCI-DTP repository | RRID: CVCL_1629 |
SKOV3 | MilliporeSigma | Cat. No. # 91091004; RRID: CVCL_0532 |
OVCAR3 | NCI-DTP repository | RRID: CVCL_0465 |
HEK293T | ATCC | Cat. No. # CRL-3216; RRID: CVCL_0063 |
Recombinant DNA | ||
mGBP2b overexpression: pLV{Exp}-mCherry:T2A:Puro-EF1A>mGbp2b{NM_010259.2} | VectorBuilder | Vector ID: VB180117-1093kbb |
mGBP2b shRNA: pLV{shRNA}-EGFP:T2A:Puro-U6>mGbp2b{shRNA# TGGGATTGGCATGTTATAAAC} | VectorBuilder | Vector ID: VB180117-1250gdh |
hGBP1 overexpression: pLV{Exp}-mCherry:T2A:Puro-EF1A>hGBP1{NM_002053.2} | VectorBuilder | Vector ID: VB170503-1150awy |
hGBP1 shRNA: pLV{shRNA}-EGFP:T2A:Puro-U6>hGBP1{shRNA# CCAGATGAGTACCTGACATAC} | VectorBuilder | Vector ID: VB170507-1030ruw |
Vector Control: pLV{Exp}-mCherry:T2A:Puro-EF1A>ORF_Stuffer | VectorBuilder | Vector ID: VB230206-1323fan |
Scramble shRNA Control: pLV{shRNA}-EGFP:T2A:Puro-U6>Scramble_shRNA {CCTAAGGTTAAGTCGCCCTCG} | VectorBuilder | Vector ID: VB170507-1033npu |
Chemicals, peptides, and recombinant proteins | ||
DMEM | Corning | Cat. No. #10-013-CV |
RPMI-1640 | Corning | Cat. No. #10-040-CV |
FBS | Corning | Cat. No. #35-015-CV |
Antibiotic-Antimycotic solution | Corning | Cat. No. #15240062 |
Puromycin | InvivoGen | Cat. No. #ant-pr-1 |
Paclitaxel | Cayman Chemical | Cat. No. # 10461100 |
DMSO | MP Biomedicals | Cat. No. #196055 |
SU093 (NSC756093) | Malhotra lab | Andreoli et al., 201428 |
Antibodies | ||
GBP1 | Abnova | Cat. No. #H00002633-PW1; RRID: AB_10716038 |
GBP1 | Novusbio | Cat. No. # NBP2-03972 |
β-actin | CST | Cat. No. # 4970S; RRID: AB_2223172 |
Ub | CST | Cat. No. # 43124S; RRID: AB_2799235 |
PSMB1 | Thermo Scientific | Cat. No. # PA5-49648; RRID: AB_2635102 |
PSMB6 | Thermo Scientific | Cat. No. # PA1-978; RRID: AB_2172197 |
PSMA3 | Proteintech | Cat. No. # 11887-I-AP; RRID: AB_2171420 |
Rabbit IgG | EMD Millipore | Cat. No. # PP64B; RRID: AB_145841 |
Anti-mouse IgG HRP-linked antibody | CST | Cat. No. #7076; RRID: AB_330924 |
Anti-rabbit IgG HRP-linked antibody | CST | Cat. No. #7074; RRID: AB_2099233 |
Critical commercial assays | ||
M-PER™ lysis solution | Thermo Scientific | Cat. No. #78503 |
Halt protease and phosphatase inhibitor cocktail | Thermo Scientific | Cat. No. #78440 |
Tandem Mass Tag (TMT) | Thermo Fisher Scientific | Cat. No. # 90110, Cat. No. #90061 |
Proteasome Activity Assay kit | Abcam | Cat No. # ab107921 |
Experimental models: Organisms/strains | ||
C57BL/6J | The Jackson Laboratory | Strain #:000664, RRID: IMSR_JAX:000664 |
Deposited data | ||
Mass spectrometry proteomics data | PRIDE database |
http://www.ebi.ac.uk/pride Dataset identifier: PXD040444 reviewer_pxd040444@ebi.ac.uk |
Software and algorithms | ||
GraphPad Prism 9 | GraphPad Software | https://www.graphpad.com/ |