Key resources table
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Anti-Cas9 antibody | Abcam | Cat#Ab191468 |
| GAPDH antibody | Santa Cruz Biotechnology | Cat#Sc-47724 |
| B-Actin antibody | Cell Signaling Technology | Cat#8844 |
| Goat Anti-Mouse IgG H&L (HRP) | Abcam | Cat#Ab205719 |
| Anti-centromere protein antibody | Antibodies Incorporated | SKU 15-234 |
| Anti-a-Tubulin antibody | Sigma-Aldrich | T9026 |
| CyTM3 AffiniPure Donkey Anti-Mouse IgG | Jackson ImmunoResearch | 715-165-150; RRID: AB_2340813 |
| Alexa Fluor® 647 AffiniPure F(ab’)₂ Fragment Donkey Anti-Human |
Jackson ImmunoResearch | 709-606-149; RRID: AB_2340581 |
| TotalSeq-B0256 anti-human Hashtag 1 Antibody | BioLegend | Cat#394631 |
| TotalSeq-B0256 anti-human Hashtag 2 Antibody | BioLegend | Cat#394633 |
| TotalSeq-B0256 anti-human Hashtag 3 Antibody | BioLegend | Cat#394635 |
| TotalSeq-B0256 anti-human Hashtag 4 Antibody | BioLegend | Cat#394637 |
| TotalSeq-B0256 anti-human Hashtag 5 Antibody | BioLegend | Cat#394649 |
| TotalSeq-B0256 anti-human Hashtag 6 Antibody | BioLegend | Cat#394641 |
| TotalSeq-B0256 anti-human Hashtag 7 Antibody | BioLegend | Cat#394643 |
| TotalSeq-B0256 anti-human Hashtag 8 Antibody | BioLegend | Cat#394645 |
| TotalSeq-B0256 anti-human Hashtag 9 Antibody | BioLegend | Cat#394647 |
| TotalSeq-B0256 anti-human Hashtag 10 Antibody | BioLegend | Cat#394649 |
| Anti-yH2A.X Antibody | Sigma-Aldrich | SKU 05-636 |
| Alexa Fluor® 647 AffiniPuro Goat Anti-Human | Jackson ImmunoResearch | 109-605-044; RRID: AB_2337885 |
| Alexa Fluor® 488 AffiniPuro Donkey Anti-Rabbit | Jackson ImmunoResearch | 711-545-152; RRID: AB_2313584 |
| Anti-Smad2 antibody | Abcam | Cat#Ab40855 |
| Smad4 Antibody | Santa Cruz Biotechnology | Cat#Sc-7966 |
| Bacterial and virus strains | ||
| Biological samples | ||
| Chemicals, peptides, and recombinant proteins | ||
| Pierce FITC Conjugated Avidin | ThermoFisher Scientific | Cat#21221 |
| Anti-Digoxigenin-Rhodamine, Fab fragments | Sigma-Aldrich | Cat#112077509 1 |
| RO-3306 | Sigma-Aldrich | Cat#SML0569; CAS: 872573-93-8 |
| MG-132 | Tocris | Cat#1748; CAS: 133407-82-6 |
| Colcemid | Roche | Cat#102958920 01 |
| Doxycycline | Sigma | Cat#D5207 |
| Shield-1 | CheminPharma | CIP-S1-0.5nM |
| Lipofectamine 3000 Transfection Reagent | ThermoFisher Scientific | Cat#L3000075 |
| DAPI | Sigma-Aldrich | Cat#MBD0015; CAS:28718-90-3 |
| ProLong Glass Antifade Moutant | ThermoFisher Scientific | Cat#P36980 |
| Critical commercial assays | ||
| Gateway LR Clonase II Enzyme mix | ThermoFisher Scientific | Cat#11791020 |
| Chromosome 7 Control Probe | Empire Genomics | Cat#CHR07-10GR |
| Chromosome 18 Control Probe | Empire Genomics | Cat#CHR18-10-GR |
| NEBNext dsDNA Fragmentase | New England Biolabs | Cat#M0348 |
| NEBNext Ultra II DNA Library Prep Kit for Illumina | New England Biolabs | Cat#E7645L |
| Qubit 2.0 fluorometer | Invitrogen | Cat#Q32866 |
| Qubit dsDNA HS kit | Invitrogen | Cat#Q32854 |
| RNeasy Mini Kit | Qiagen | Cat#74106 |
| 2100 Bioanalyzer system | Agilent | Cat#G2939BA |
| TruSeq Stranded Total RNA Library Prep Gold | Illumina | Cat#20020598 |
| Agilent 2200 TapeStation System | Agilent | G2964AA |
| Agilent High Sensitivity D1000 ScreenTape | Agilent | 5067-5584 |
| NovaSeq 6000 SP Reagent Kit v1.5 (100 cycles) | Illumina | Cat#20028401 |
| Chromium Single Cell 3’ GEM, Library & Gel Bead Kit v3 | 10X Genomics | PN-1000075 |
| Chromium Single Cell B Chip Kit | 10X Genomics | PN-1000073 |
| Chromium i7 Multiplex Kit | 10X Genomics | Pn-120262 |
| Experimental models: Cell lines | ||
| hCEC hTERT | Ly et al.38 | PMC:3071083 |
| hCEC hTERT TP53−/− | This paper | N/A |
| HCT116 | ATCC | CCL-247 |
| RPE hTERT | ATCC | CRL-4000 |
| RPE hTERT p21/Rb shRNA | Maciejowski et al.39 | PMID:26687355 |
| Experimental models: Organisms/strains | ||
| Oligonucleotides | ||
| gNC: ACGGAGGCTAAGCGTCGCAA | Sanjana et al.40 | N/A |
| Chromosome-specific gRNAs, see table S1 | This paper | N/A |
| SMAD4 CRISPRi gRNA: GGCAGCGGCGACGACGACCA |
Gilbert et al.76 | N/A |
| Recombinant DNA | ||
| plentiGuide-Puro | Chen et al.72 | Addgene #52963 |
| pLentiGuide-Puro-FE | This paper | N/A |
| pX330-U6-Chimeric_BB_CBh-hSpCas9 | Cong et al.74 | Addgene #42230 |
| Chromosome 7 BAC | BACPAC Genomics | RP11-22N19 |
| Chromosome 13 BAC | BACPAC Genomics | RP11-76N11 |
| Chromosome 18 BAC | BACPAC Genomics | RP11-787K12 |
| H2B-GFP plasmid | Titia de Lange lab | pCLRNX-H2B-GFP |
| pHAGE-3xmScarlet-dCas9 | This paper | N/A |
| pHAGE-KNL1Mut-dCas9 | This paper | N/A |
| pIND20-KNL1Mut-dCas9 | This paper | N/A |
| pIND20-GFP | This paper | N/A |
| pHAGE-DD-KNL1Mut-dCas9 | This paper | N/A |
| pHAGE-KNL1S24A;S60A-dCas9 | This paper | N/A |
| pHAGE-dCas9 | This paper | N/A |
| pHAGE-NDC80CH1-dCas9 | This paper | N/A |
| pHAGE-NDC80CH2-dCas9 | This paper | N/A |
| pInducer20 | Meerbrey et al.44 | Addgene #44012 |
| Software and algorithms | ||
| Photoshop v21.2.3 | Adobe | https://www.adobe.com |
| FIJI/ImageJ2 version 2.3.0/1.53f | Schindelin et al.75 | https://imagej.nih.gov/ij/download.html |
| Python 3.7 | Python Software Foundation | https://www.python.org/downloads/ |
| Scikit-image | Van Der Walt et al.77 | https://scikiti-mage.org |
| BWA-mem v0.7.17 | Li et al.78 | https://github.com/lh3/bwa/releases/tag/v0.7.17 |
| Genome Analysis Toolkit v4.1.7.0 | Van der Auwera, 202079 | https://gatk.broadinstitute.org/hc/en-us |
| CopywriteR v1.18.0 | Kuilman et al.80 | https://github.com/PeeperLab/CopywriteR |
| Seq-N-Slide | Dolgalev, 2022.81 | https://github.com/igordot/sns |
| Trimmomatic | Bolger et al.82 | https://github.com/timflutre/trimmomatic |
| STAR | Dobin et al.83 | https://github.com/alexdobin/STAR |
| featureCounts | Liao et al.84 | https://github.com/byee4/featureCounts |
| DESeq2 | Love et al.50 | https://bioconductor.org/packages/release/bioc/html/DESeq2.html |
| GSEA pre-ranked | Subramanian et al.85 | https://www.gsea-msigdb.org/gsea/doc/GSEAUserGuideFrame.html |
| CellRanger v6.1 | 10X Genomics | https://support.10xgenomics.com/single-cell-geneexpression/software/overview/welcome |
| Seurat v4.0.3 | Hao et al.86 | https://github.com/satijalab/seurat |
| CopyKat v1.0.5 | Gao et al.46 | https://github.com/navinlabcode/copykat |
| ComplexHeatmap v2.8 | Gu et al.87 | https://bioconductor.org/packages/release/bioc/html/ComplexHeatmap.html |
| Other | ||
| Code for automated FISH foci counting | This paper | https://doi.org/10.6084/m9.figshare.21843393 |
| Code for single-cell RNA-seq analysis | This paper | https://doi.org/10.6084/m9.figshare.21843393 |
| Glass-bottom microwell dishes | MatTek | Cat# P35G-1.5-14-C |
| NuPAGE LDS Sample Buffer (4X) | Invitrogen Invitrogen |
Cat#NP0007 |
| NuPAGE 4 to 12% Bis-Tris Mini Protein Gels | Cat#NP0322BO X |
|
| Trans-Blot Turbo Mini 0.45 uM LF PVDF Transfer Kit | Bio-Rad | Cat#1704274 |
| Human Cot-1 DNA | ThermoFisher Scientific | Cat#15279011 |
| UltraPure Herring Sperm DNA Solution | ThermoFisher Scientific | Cat#15634017 |
| Proteinase K | Qiagen | Cat#19131 |
| Pierce ECL Western Blotting Substrate | Thermo Scientific | Cat#32209 |
| Sera-Mag Select beads | Cytiva | Cat#29343052 |
| Single-cell and bulk RNA sequencing data | This paper |
GSE217326; https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE217326 |
| Whole genome sequencing data | This paper | PRJNA899849;https://dataview.ncbi.nlm.nih.gov/object/PRJNA899849 |
| T2T Chm13v2.0.fa.gz assembly | Nurk et al.29 | GCA_00991475 5.4 https://github.com/marbl/CHM13 |
| GRChg38 reference assembly | Schneider et al.30 | GCA_00000140 5.28 https://hgdownload.soe.ucsc.edu/downloads.html |
| TCGA data | NA | https://www.cancer.gov/aboutnci/organization/ccg/research/structuralgenomics/tcga/using-tcga/tools |
| TUSON data | Davoli et al.4 | NA |