Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2023 Nov 26;13:20767. doi: 10.1038/s41598-023-48022-7

SSR molecular marker developments and genetic diversity analysis of Zanthoxylum nitidum (Roxb.) DC

Yanxia Zhu 1, Tao Ma 2, Yang Lin 1, Yude Peng 1, Yuan Huang 1, Jianping Jiang 1,
PMCID: PMC10679188  PMID: 38008750

Abstract

Zanthoxylum nitidum (Roxb.) is a commonly used traditional Chinese medicine. However, the collection and protection of wild germplasm resources of Z. nitidum are still insufficient, and there is limited research on its genetic diversity and fingerprint. In the present study, 15 simple sequence repeat (SSR) markers were developed by genotyping based on multiplexed shotgun sequencing. The genetic diversity of 51 populations (142 individuals) of Z. nitidum was evaluated using these 15 SSRs. A total of 245 alleles (Na) were detected, with an average value of 16.333, and the average polymorphism information content was 0.756. The genetic distance among 51 populations was 0.164~1.000, with an average of 0.659. Analysis of molecular variance showed low genetic differentiation (40%) and high genetic differentiation (60%) between populations and individuals, respectively. The genetic differentiation coefficient (Fst) of the population was 0.338, indicating that 66.2% of the genetic variation occurred within the population, and the gene flow (Nm) was 0.636, demonstrating that the gene exchange between populations was low. Clustering analysis revealed that the genetic similarity coefficient was 0.30, dividing the 51 populations into 4 groups of 2, 17, 3, and 29 populations. There was no specific relationship between geographical location differences and genetic distance. The genetic diversity level of Z. nitidum is relatively high, and our results provide a theoretical basis for the rapid identification of Z. nitidum germplasm resources and variety selection.

Subject terms: Agricultural genetics, Genetic markers

Introduction

Zanthoxylum nitidum (Roxb.) DC., a notable medicinal plant, belongs to the genus Zanthoxylum in the Rutaceae family, the root used as traditional medicine is named Liang-Mian-Zhen1. Z. nitidum was first recorded in "Shennong Materia Medica Classic" during the Qin and Han dynasties under the name "Manjiao"2. It mainly grows in Guangxi, Guangdong, and other locations in China3. The roots mainly contain alkaloids4,5, sesquiterpenoids6, coumarins7, lignans8, and other components that have various pharmacological activities, such as antiinflammatory9,10, antibacterial11,12, anticancer13 and analgesic14 activities. Z. nitidum is not only the main raw material of more than 60 famous traditional Chinese patent medicines and simple preparations, such as Sanjiu Weitai Granules, LiangMianZhen Analgesic Tablets, and Dieda Wanhua Oil, but its extracts are widely used in toothpaste, soap, shampoo and other daily personal products15,16.

Zanthoxylum nitidum can be subdivided into Z. nitidum var. nitidum and Z. nitidum var. tomentosum according to whether each section of the plant has short, rough hairs, particularly on both sides of the leaves. Furthermore, Z. nitidum var. nitidum is separated into three types based on the number of thorns on branches and leaf axes, as well as the size and thickness of leaflets3,17. Due to the high demand for Z. nitidum in the market, wild resources have been plundered recklessly for a long time, and have become increasingly scarce17,18. The fundamental measure to solve the resource crisis is to transform the source from wild to artificially planted. However, in the process of introducing and domesticating wild Z. nitidum germplasm, it is difficult to accurately distinguish resources with such similar traits using traditional morphological identification methods. Hence, there is a serious shortage of excellent germplasm basic materials for artificial cultivation, and the unclear phenotypic characteristics and genetic background of cultivated germplasm are unclear, which seriously limits the development of related industries for Z. nitidum.

Some of the advantages of simple sequence repeat (SSR) molecular markers are rich polymorphism, wide distribution, easy operation, and high sensitivity19. SSR molecular markers have been widely used in genetic diversity analysis, population structure analysis, and fingerprint construction of medicinal plants, such as for Astragali Radix20, Akebia trifoliata21, and Paris polyphylla22, providing new ideas for the protection of core germplasms, functional gene identification, variety identification, and molecular marker assisted breeding of medicinal plants. However, studies on the genetic diversity of Z. nitidum are limited, and one of the most important reasons is the lack of effective molecular markers for this species.

In this study, great efforts were made to collect wild germplasm resources of Z. nitidum from Guangxi and Guangdong. We detected an abundance of SSRs based on the multiplexed shotgun genotyping (MSG) data, and we developed SSR molecular markers to assess the level of genetic diversity for the collected germplasm resources. Our data will provide a scientific basis for species identification and selective breeding of Z. nitidum.

Materials and methods

Plant materials and DNA extraction

From September to October 2022, a total of 142 Z. nitidum var. nitidum and Z. nitidum var. tomentosum individuals from 51 populations in Guangdong and Guangxi were collected, including 16 germplasms from 7 artificially cultivated populations and 126 germplasms from 44 wild populations. The germplasm numbers and source information are shown in Table S1. Fresh young leaves were collected and stored at − 80 °C for DNA extraction. Total genomic DNA was extracted from the frozen leaves following the instructions of Magnetic Bead Method using a Plant Genomic Extraction Kit (NanoMagBio, Wuhan, China). The concentration and purity of DNA were determined by using an ultramicro spectrophotometer (NanoDrop ONE, Thermo Fisher, USA).

MSG library construction and sequencing

Three germplasms with significant phenotypic differences (GX0826-1, bl0915-1, 3-1) were selected for constructing the library. We prepared the sequencing library using the MSG method proposed by Andolfatto et al.23. We purified the libraries and selected DNA fragments in the 400 bp size range using AMPure XP beads (Beckman Coulter, Inc., USA), and then amplified them using PCR for 14 cycles. The Illumina NovaSeq platform (Illumina, Inc., San Diego, USA) was used to obtain raw sequence data. The original data were filtered using the sliding window analysis method of fastp (v0.20.0)24, and the sequences were integrated using FLASH (v1.2.11)25 to obtain high-quality data. The sequencing data have been deposited in China National GeneBank (CNGB) with project accession number CNP0004226 (https://db.cngb.org/search/project/CNP0004226/).

SSR primer pair design

The Microsatellite Identification Tool (MISA) (http://pgrc.ipk-gatersleben.de/misa/) was used to search for SSR loci in all high-quality sequences. Cd-hit software26 was used to cluster the sequences. The Perl program was used to analyze the clustering results and evaluate polymorphisms27. Finally, PCR primer pairs flanking the SSR repeats were designed using primer 3 (v2.3.6)28.

SSR analysis and screening

SSRs were classified based on the length of the SSR motifs in their sequences. Different repeats of the SSR motifs were used to analyze the characteristics of the SSRs. We randomly selected 192 pairs of primers, and preliminarily screened 10 germplasms with significant phenotypic differences (GX0826-1, bl0915-1, 3-1, te0920-1, jx0928-1, pg1001-1, tl1004-1, qb1007-1-1, nv-1, py1-1). PCR reaction was performed using a Veriti 384 PCR instrument(Veriti 384, AppliedBiosystem,USA). The PCR reaction system was as follows: template DNA 1 μL, forward and reverse primers are both 10 pmol/μL (Shanghai, Shanghai), 0.5 μL each, 5 μL of MIX enzyme (2 × Taq PCR Master Mix, GeneTech, USA) supplemented with 3 μL ddH2O (total 10 μL). The reaction conditions were as follows: predenaturation at 95 °C for 5 min, 25 cycles of denaturation at 95 °C for 30 s, gradient annealing at 62~52 °C for 30 s, extension at 72 °C for 30 s, followed by extension at 72 °C for 20 min. Polymorphism of each successfully amplified marker was evaluated by GeneMarker software.

Fluorescence capillary electrophoresis detection

Fluorescent primers were obtained from Wuhan Tianyi Huiyuan Biotechnology Co., Ltd. (Wuhan, China), and the fluorescent dyes used were FAM, HEX, and TAMRA. One microliter of fluorescent PCR product, 0.5 μL of GeneScan™500 LIZ, and 8.5 μL of Hi-Di™ formamide were added to the upper plate, centrifuged, denatured (95 °C for 5 min), and cooled. Finally, the samples were analyzed using an ABI3731XL sequence analyzer (AppliedBiosystem, USA).

Genetic diversity analysis

GenAlEx (v6.501) software was used to calculate genetic diversity indicators29, including the number of observed alleles (Na), effective alleles (Ne), observed heterozygosity (Ho), expected heterozygosity (He), fixation index (F), Shannon’s information index (I), genetic differentiation coefficient (Fst), gene flow (Nm) and analysis of molecular variance (AMOVA). Linkage Disequilibrium between the SSR loci was carried out using the SHEsis plus30. The genetic distance among populations was calculated using Powermarker (V3.25)31. The genetic structure of the germplasm was analyzed using STRUCTURE software (v2.3.4)32, and cluster analysis between populations was based on unweighted pair group with arithmetic average (UPGMA).

Plant collecting permit declaration

The plant materials used in this article did not involve disputes. We hereby declare that all of the plant materials (Z. nitidum var. nitidum and Z. nitidum var. tomentosum) were collected in compliance with institutional, national, and international guidelines and legislation. The plant material in our collection is preserved in the Germplasm Repository of Guangxi Botanical Garden of Medicinal Plants, Guangxi Province, China. The voucher ID for each sample is shown in Table S1. The formal identification of these plant materials was performed by Prof. Yudeng Peng (Guangxi Botanical Garden of Medicinal Plants, China).

Result analysis

SSR quantity analysis

MSG data of the three samples (GX0826-1, bl0915-1, and 3-1) were 8.63 Gb, 6.66 Gb, and 9.35 Gb, respectively. After filtering, high-quality data were generated, which were 1.30 Gb, 0.93 Gb, and 1.20 Gb, respectively. Furthermore, 2,903,693 pairs of read pairs were merged from a total of 12,014,757 pairs. Using MISA software, 261,267 SSR loci were found, distributed among 227,023 unigenes. The frequency of SSR occurrence (the proportion of sequences containing SSR loci to all sequences) was 7.82%. The average distance (total sequence length divided by the total number of SSRs) was 2.73 kb. Among them, there were 30,512 unigenes containing more than one SSR locus, and 29,314 SSRs were present in composite form (Table 1).

Table 1.

SSR search results based on MSG data.

Item Number
Number of sequences analyzed 2,903,693
Length of sequences/bp 713,743,318
Number of SSR 261,267
Number of sequences with SSRs 227,023
Number of sequences with more than one SSRs 30,512
Number of SSRs present in compound formation 29,314
Occurrence frequency of SSR / % 7.82
Average distance/kb 2.73

SSR polymorphisms

SSRs with mono, di-, tri-, tetra-, penta-, and hexanucleotide repeat units were identified based on MSG data. Among the SSRs, mononucleotide (207,994, 79.61%) was the most abundant repeat type, followed by dinucleotide loci (32,332, 12.38%), trinucleotide loci (17,637, 6.75%), tetranucleotide loci (2265, 0.87%), hexanucleotide loci (525, 0.20%), and pentanucleotide loci (514, 0.20%). Moreover, the three types of repetitive motifs with the highest number were A/T (207,789, 79.53%), AT/AT (19,881, 7.61%), and AAT/ATT (8245, 3.16%) (Table 2).

Table 2.

Characterization of SSR loci.

Repeat type Repeat motif Number Percentage
Mononucleotide A/T 207,789 79.53
G/C 205 0.08
Total 207,994 79.61
Dinucleotide AC/GT 4879 1.87
AG/CT 7503 2.87
AT/AT 19,881 7.61
CG/CG 69 0.03
Total 32,332 12.38
Trinucleotide AAC/GTT 1097 0.42
AAG/CTT 3280 1.26
AAT/ATT 8245 3.16
ACC/GGT 858 0.33
ACG/CGT 271 0.10
ACT/AGT 97 0.04
AGC/CTG 1156 0.44
AGG/CCT 502 0.19
ATC/ATG 1667 0.64
CCG/CGG 464 0.18
Total 17,637 6.75
Tetranucleotide Total 2265 0.87
Pentanucleotide Total 514 0.20
Hexanucleotide Total 525 0.20

SSR marker development

On the basis of the identified SSR loci, 768 primer pairs were designed (Table S2). Among the 192 randomly selected SSR markers (Table S3) screened using 10 selected populations, 39 SSR markers with polymorphisms were preliminarily screened, with a polymorphism rate of 20.31%. Then, 15 randomly selected SSR markers were used for genetic diversity analysis of 51 Z. nitidum populations (Table 3).

Table 3.

List of 15 SSR markers used in the present study.

locus Repeating motif Forward primer Reverse primer Expected product size / bp Fluorescent labeling
ZYX006 (GT)11 GGGGAAACCATTGAGCATAA ACCTCTTGGAATCGGTGACA 166 FAM (blue)
ZYX149 (AG)6 GGTGGTGCCAGCTGAATTAT CCGATAACAAGAGCATGGGT 211 FAM (blue)
ZYX148 (CAG)6 TGAACACACCGTCTCCTCAG GACTGCCTGAACTGTTGCTG 133 FAM (blue)
ZYX119 (TG)7 TGCAACAAGACTAATGCACAAA TGAGTATGATTGCAGGTGCC 190 FAM (blue)
ZYX137 (AG)8 TCGTGATTGCGAAGATTAGG ATGCGCATCTTCTTCAGCTT 243 FAM (blue)
ZYX031 (ATA)6 CCATAAACTTTCCTCTTTCGATG CCAGCAAAAGCTCCAGAATC 134 FAM (blue)
ZYX163 (ATT)5 CGGAGGCTATTCTGCATTTC CGAATCGAGACCGTTCATTT 178 FAM (blue)
ZYX050 (AT)7 AAATCCGAGATACCTTTTAAAGCA ACTCAACTGCAGAATCGGCT 155 FAM (blue)
ZYX191 (AG)10 AGACACACAAGCACACGAGC CTAAGCGACCGACATTCAGG 142 FAM (blue)
ZYX092 (ATA)8 TGAAGCAACTGCTAGCAACG CTGGTCCTCCCTTCCTCTCT 213 FAM (blue)
ZYX004 (GT)9 TCCCTTGCAATTCCCAATAC CTCTTCTTGCTGCCGCTACT 153 FAM (blue)
ZYX182 (CTT)7 AAGCAACCAAAAGCGTCACT CCCGATTATGGGGTAGGATT 193 FAM (blue)
ZYX022 (ATT)18 TTGGAAGCCATCTGACTGTG CGGGATTGGAAGAGTACTGG 212 FAM (blue)
ZYX171 (TA)7 TGCAGCAAACCGTTTACAAG GAGCGAGTCTGGAGAAGCAG 129 FAM (blue)
ZYX056 (AG)9 GCTCAAAACAAGAGCACGAA TCCACTCTGCTATTTCTGCTAGG 230 FAM (blue)

SSR marker detection

A total of 245 alleles (Na) from 15 developed SSR markers were amplified from the 51 populations (142 individuals). The total effective alleles (Ne) were 85.828, with an average of 5.722, and the proportion of effective alleles was 35.03%. Shannon’s information index (I) ranged from 1.313 to 2.994, with an average value of 1.984. The polymorphism information content (PIC) ranged from 0.531 to 0.922, with an average of 0.756. All loci were not conforming to the Hardy–Weinberg equilibrium (Table 4). The linkage disequilibrium distribution pattern based on R2 values between SSR loci is shown in Fig. 1. R2 ranged between 0.01 and 0.39, indicating a relatively low degree of linkage. These results show that the 15 loci those were chosen have a high degree of polymorphism and can be utilized for further research on Z. nitidum's genetic diversity.

Table 4.

Genetic diversity parameters of 15 SSR markers.

locus Na Ne I Ho He F PIC P value Significance
ZYX004 9 5.567 1.896 0.440 0.820 0.464 0.798 0.000 ***
ZYX006 12 6.463 2.007 0.681 0.845 0.195 0.826 0.000 ***
ZYX022 32 9.876 2.902 0.676 0.899 0.248 0.894 0.000 ***
ZYX031 10 2.567 1.36 0.270 0.610 0.559 0.580 0.000 ***
ZYX050 15 2.728 1.510 0.359 0.633 0.433 0.604 0.000 ***
ZYX056 11 3.473 1.668 0.411 0.712 0.422 0.686 0.000 ***
ZYX092 13 2.271 1.313 0.114 0.560 0.796 0.531 0.000 ***
ZYX119 11 3.533 1.669 0.279 0.717 0.611 0.691 0.000 ***
ZYX137 33 13.464 2.994 0.660 0.926 0.288 0.922 0.000 ***
ZYX148 9 4.760 1.704 0.493 0.790 0.376 0.759 0.000 ***
ZYX149 14 4.993 1.925 0.578 0.800 0.278 0.775 0.000 ***
ZYX163 37 6.226 2.572 0.546 0.839 0.349 0.829 0.000 ***
ZYX171 12 6.120 1.996 0.657 0.837 0.215 0.817 0.000 ***
ZYX182 10 4.458 1.793 0.411 0.776 0.470 0.751 0.000 ***
ZYX191 17 9.329 2.457 0.637 0.893 0.286 0.884 0.000 ***
Mean 16 5.722 1.984 0.481 0.777 0.399 0.756
St Dev 9 3.104 0.523 0.174 0.110 0.165

The P-value is the testing result of the Hardy–Weinberg equilibrium, and the smaller the p-value, the loci that do not conform to expectations of Hardy–Weinberg equilibrium.

Figure 1.

Figure 1

Linkage disequilibrium distribution pattern based on R2 values between SSR loci. The color of the box ranges from white to red, representing the level of linkage disequilibrium from low to high.

Population genetic diversity

Statistical analysis showed that the maximum genetic distance among 51 populations was 1.000, the minimum was 0.164, and the average was 0.659 (Table S4). The results obtained for population-level indices of genetic diversity in each population are shown in Table 5. The average values of Na, Ne, I, Ho, He and F at the population level were 2.220, 1.964, 0.619, 0.478, 0.380, and − 0.268, respectively. Taken together, these results indicate that POP15 and POP1 exhibit the highest and lowest levels of genetic diversity, respectively.

Table 5.

Genetic diversity of 51 populations.

Pop Na Ne I Ho He F
POP1 1.267 1.267 0.185 0.267 0.133 − 1.000
POP2 2.600 2.134 0.736 0.622 0.430 − 0.441
POP3 2.933 2.482 0.881 0.578 0.504 − 0.173
POP4 2.267 1.928 0.635 0.356 0.389 0.060
POP5 2.067 1.796 0.567 0.422 0.359 − 0.170
POP6 2.267 2.071 0.704 0.467 0.450 − 0.036
POP7 1.467 1.364 0.274 0.233 0.183 − 0.267
POP8 2.200 1.767 0.590 0.389 0.362 − 0.073
POP9 2.200 2.058 0.629 0.600 0.383 − 0.573
POP11 2.333 2.018 0.643 0.333 0.381 0.079
POP12 2.267 1.872 0.621 0.489 0.378 − 0.274
POP13 1.733 1.640 0.430 0.467 0.283 − 0.667
POP14 1.667 1.503 0.390 0.378 0.263 − 0.393
POP15 3.267 2.927 1.043 0.733 0.600 − 0.239
POP16 2.133 1.940 0.628 0.489 0.399 − 0.237
POP17 2.333 1.968 0.600 0.400 0.342 − 0.168
POP18 1.933 1.769 0.514 0.333 0.325 − 0.007
POP19 1.800 1.607 0.415 0.356 0.259 − 0.320
POP20 2.933 2.527 0.907 0.444 0.522 0.106
POP21 2.800 2.393 0.855 0.533 0.500 − 0.032
POP22 2.667 2.238 0.792 0.467 0.467 0.026
POP23 2.600 2.398 0.827 0.711 0.504 − 0.437
POP24 1.867 1.633 0.464 0.467 0.296 − 0.549
POP25 1.400 1.400 0.277 0.400 0.200 − 1.000
POP26 1.467 1.467 0.323 0.467 0.233 − 1.000
POP27 3.000 2.455 0.880 0.578 0.496 − 0.147
POP28 2.133 1.941 0.553 0.489 0.326 − 0.508
POP29 1.533 1.520 0.366 0.511 0.263 − 0.938
POP30 1.733 1.570 0.363 0.267 0.219 − 0.244
POP32 1.733 1.692 0.492 0.689 0.352 − 0.927
POP33 2.333 1.946 0.677 0.622 0.419 − 0.447
POP34 1.667 1.626 0.446 0.622 0.319 − 0.920
POP35 1.667 1.544 0.406 0.467 0.278 − 0.648
POP36 2.400 2.056 0.683 0.467 0.411 − 0.114
POP37 1.733 1.733 0.508 0.733 0.367 − 1.000
POP38 2.533 2.172 0.704 0.433 0.403 − 0.062
POP39 2.400 2.002 0.658 0.422 0.389 − 0.106
POP40 1.600 1.559 0.400 0.556 0.285 − 0.911
POP41 2.533 2.167 0.755 0.300 0.454 0.428
POP42 2.533 2.020 0.703 0.444 0.411 − 0.133
POP43 2.200 1.899 0.607 0.556 0.374 − 0.472
POP44 2.867 2.600 0.970 0.533 0.583 0.105
POP45 2.467 2.114 0.739 0.456 0.453 − 0.014
POP46 2.067 1.942 0.621 0.333 0.408 0.189
POP47 2.867 2.485 0.843 0.511 0.478 − 0.072
POP48 2.533 2.256 0.715 0.467 0.419 − 0.087
POP49 2.133 1.794 0.554 0.467 0.337 − 0.371
POP50 2.400 2.187 0.713 0.533 0.425 − 0.261
POP51 2.933 2.517 0.886 0.556 0.507 − 0.090
POP52 2.267 2.021 0.619 0.422 0.367 − 0.083
POP53 2.467 2.160 0.774 0.567 0.475 − 0.210
Mean 2.220 1.964 0.619 0.478 0.380 − 0.268
Max 3.267 2.927 1.043 0.733 0.600 0.428
Min 1.267 1.267 0.185 0.233 0.133 − 1.000

Genetic differentiation

According to AMOVA, 40% of the total genetic variation originated from variability among the populations, whereas 60% was attributed to within-individual differences (Table 6). F-statistical analysis revealed that the genetic differentiation coefficient (Fst) of the population was 0.338, and the gene flow (Nm) was 0.636 (Table S5).

Table 6.

Analysis of the molecular variance (AMOVA) of the 142 individuals.

Source of variation df SS MS Est. var Variation percentage (%)
Among populations 50 835.553 16.711 2.355 40
Within individuals 142 503.500 3.546 3.546 60
Total 283 1666.803 5.929 100

df degree of freedom, SS Total variance, MS Mean square deviation, Est. Var. Estimated difference value.

Phylogeny tree

According to Nei's genetic similarity coefficient, the UPGMA method was used to construct a phylogenetic tree. The genetic similarity coefficient variation of 51 populations ranged from 0 to 0.44, and when the similarity coefficient was 0.30, they could be clustered into 4 clusters (Fig. 2). Cluster I contained 2 populations, both of which have been identified as Z. nitidum var. tomentosum. Cluster II contained 17 populations, all of which have been identified as type 1 of Z. nitidum var. nitidum. Cluster III included 3 populations from Guangdong, all of which have been identified as type 3 of Z. nitidum var. nitidum. Cluster IV contained 29 populations, including all 7 cultivated populations, all of which have been identified as type 2 of Z. nitidum var. nitidum.

Figure 2.

Figure 2

Phylogeny tree of 51 populations.

Discussion

SSRs, as important molecular markers, have been widely used in genetic diversity evaluation, genetic map, construction, and finger mapping in medicinal plants, such as for the medicinal plants Aristolochia delavayi33, Andrographis paniculata34, and Paris polyphylla35. However, genetic research on Z. nitidum has been hampered due to limited genetic information. MSGs were used for high-throughput discovery of SSRs23. It was confirmed that MSG is similar in essence to restriction site-associated DNA (RAD) sequencing36 and whole-genome resequencing (WGD)37, and it is more effective and flexible for detecting SSRs. In this study, 261,267 SSR loci by MSG were discovered.

The number of Na, Ne, Ho, He, F, I, and PIC of primers are important indicators for measuring polymorphism of SSR markers. When PIC > 0.5, it indicates that the primer has a high degree of polymorphism38. In this study, we designed 768 SSRs based on MSG data, and screened out specific markers of Z. nitidum form them. To evaluate the effectiveness of the designed SSR primers, we randomly selected 192 SSRs and conducted two rounds of screening based on 10 germplasms with significant phenotypic differences. Twenty-six SSRs were found to be effective. Fifteen SSRs were selected from 26 SSRs for genetic diversity analysis on 142 individuals. The PIC of these 15 SSRs ranged from 0.531 to 0.922, with an average of 0.756. These 15 SSRs have high polymorphism and can effectively reveal the genetic diversity of Z. nitidum. This is the first time SSR markers have been used for genetic diversity analysis of Z. nitidum populations; at the same time, our results confirm that SSR markers have the advantages of a large number of loci and high identification efficiency.

Among the indicators of population genetic diversity, expected heterozygosity (He)39 and Shannon’s information index (I)40 are important. The larger their values are, the richer the genetic diversity of the population is. This study found that the He of these 51 populations ranged from 0.133 to 0.600, with an average of 0.380; the I ranged from 0.185 to 1.043, with an average of 0.619. These data indicate that the 51 populations have rich genetic diversity. In general, Fst > 0.25 indicates a high level of genetic differentiation among populations41; Nm < 1 indicates that the genetic differentiation among populations is caused by migration or genetic drift42. In this study, the Fst of 51 populations was 0.338, and the Nm was 0.636, which indicated that the genetic differentiation among populations of Z. nitidum is at a high level. Additionally, the genetic differentiation between populations was caused by migration or genetic drift, which is consistent with the conclusions reached by previous researchers using ISSR molecular markers43, and similar to the results of genetic differentiation studies of other Zanthoxylum plants44,45.

Conducting variety identification by combining molecular marker technology with phenotypic analysis is reliable and convenient46,47. In our study, we constructed a UPGMA clustering tree using the 15 SSRs based on Nei's genetic similarity coefficient. Fifty-one populations could be clearly clustered into 4 clusters. Among them, the first cluster was identified as Z. nitidum var. tomentosum, indicating distant genetic relationship between Z. nitidum var. tomentosum and the rest of the germplasm with relatively clear separation. The second cluster was identified as Z. nitidum var. nitidum (type 1), indicating a distant genetic relationship between type 1 and the other two types. The third cluster was identified as Z. nitidum var. nitidum (type 3), all of which originated from Guangdong, showing obvious regional characteristics. The cluster was identified as Z. nitidum var. nitidum (type 2), with the closest genetic relationship to type 3, and included 7 artificially cultivated populations, indicating a decrease in genetic diversity after transitioning from wild to domestic. The conclusion of the genetic relationship between the four types of Z. nitidum through cluster analysis is consistent with traditional morphological identification methods and proves the effectiveness of the SSR molecular markers selected in this study for identifying Z. nitidum germplasm.

Conclusion

In this study, MSG data were used to develop SSRs, and 261,267 SSRs were detected. Fifteen SSRs were powerful molecular markers for genetic diversity analysis and variety identification in Z. nitidum. Our data will be useful for germplasm identification, genetic improvement, and variety selection.

Supplementary Information

Supplementary Table S1. (13.8KB, xlsx)
Supplementary Table S2. (145.1KB, xlsx)
Supplementary Table S3. (21.4KB, xlsx)
Supplementary Table S4. (39.9KB, xlsx)
Supplementary Table S5. (46.9KB, xlsx)
Supplementary Table S6. (28.7KB, xlsx)

Author contributions

Conceptualization: Y.Z. and J.J.; methodology: Y.Z. and Y.H.; formal analysis: Y.Z.; resources: Y.Z., T.M., Y.L. and Y.P.; writing-original draft preparation: Y.Z. and T.M.; writing-review and editing: Y.Z. and J.J. All authors reviewed the results and approved the final version of the manuscript.

Funding

This research was funded by the Scientific Research and Technology Development Program of Guangxi (GUIKE AB22035068).

Data availability

The data that support the findings of this study are available in the supplementary material of this article.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-023-48022-7.

References

  • 1.Commission SP. Pharmacopoeia of the People's Republic of China. Pharmacopoeia of the People's Republic of China; 2020. [Google Scholar]
  • 2.Sun X, Sun F. Shennong Materia Medica Classic. People's Health Publishing House; 1963. [Google Scholar]
  • 3.Huang C. Flora of China. Science Press; 1997. [Google Scholar]
  • 4.Hu J, Zhang WD, Liu RH, Zhang C, Shen YH, Li HL, Liang MJ, Xu XK. Benzophenanthridine alkaloids from Zanthoxylum nitidum (Roxb.) DC, and their analgesic and anti-inflammatory activities. Chem. Biodivers. 2006;3:990–995. doi: 10.1002/cbdv.200690108. [DOI] [PubMed] [Google Scholar]
  • 5.Yang G, Chen D. Alkaloids from the roots of Zanthoxylum nitidum and their antiviral and antifungal effects. Chem. Biodivers. 2008;5:1718–1722. doi: 10.1002/cbdv.200890160. [DOI] [PubMed] [Google Scholar]
  • 6.Qin F, Li MS, Li JJ, Wang Y, Wang K, Zhou JY, Liang D, Wang HS. Four new sesquiterpenoids from Zanthoxylum nitidum. Chem. Biodivers. 2022;19:e202200449. doi: 10.1002/cbdv.202200449. [DOI] [PubMed] [Google Scholar]
  • 7.Zuo G-Y, Wang C-J, Han J, Li Y-Q, Wang G-C. Synergism of coumarins from the Chinese drug Zanthoxylum nitidum with antibacterial agents against methicillin-resistant Staphylococcus aureus (MRSA) Phytomedicine. 2016;23:1814–1820. doi: 10.1016/j.phymed.2016.11.001. [DOI] [PubMed] [Google Scholar]
  • 8.Su J-H, Wang M-Q, Zhu L-P, Yang W-Q, Jiang S-Q, Zhao Z-X, Sun Z-H. Coumarins and lignans from the roots of Zanthoxylum nitidum. Biochem. Syst. Ecol. 2022;101:104399. doi: 10.1016/j.bse.2022.104399. [DOI] [Google Scholar]
  • 9.Qin F, Wang C-Y, Hu R, Wang C-G, Wang F-F, Zhou M-M, Liang D, Liao H-B, Lee S-K, Wang H-S. Anti-inflammatory activity of isobutylamides from Zanthoxylum nitidum var. tomentosum. Fitoterapia. 2020;142:104486. doi: 10.1016/j.fitote.2020.104486. [DOI] [PubMed] [Google Scholar]
  • 10.Bhattacharya S, Haldar PK, Zaman MK. Anti-inflammatory and in vitro antioxidant property of Zanthoxylum nitidum root. Curr. Trends Biotechnol. Pharm. 2010;4:774–783. [Google Scholar]
  • 11.Bhattacharya S, Zaman M, Haldar P. Antibacterial activity of stem bark and root of Indian Zanthoxylum nitidum. Asian J. Pharm. Clin. Res. 2009;2:30–34. [Google Scholar]
  • 12.Zhao L-N, Guo X-X, Liu S, Feng L, Bi Q-R, Wang Z, Tan N-H. (±)-Zanthonitidine A, a pair of enantiomeric furoquinoline alkaloids from Zanthoxylum nitidum with antibacterial activity. Nat. Prod. Bioprospect. 2018;8:361–367. doi: 10.1007/s13659-018-0169-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Qin F, Wang CY, Wang C-G, Chen Y, Li J-J, Li M-S, Zhu Y-K, Lee SK, Wang H-S. Undescribed isoquinolines from Zanthoxylum nitidum and their antiproliferative effects against human cancer cell lines. Phytochemistry. 2023;205:113476. doi: 10.1016/j.phytochem.2022.113476. [DOI] [PubMed] [Google Scholar]
  • 14.Qin F, Zhang H, Liu A, Wang Q, Sun Q, Lu S, Li Q, Guo H, Liu X, Lu Z. Analgesic effect of Zanthoxylum nitidum extract in inflammatory pain models through targeting of ERK and NF-κB signaling. Front. Pharmacol. 2019;10:359. doi: 10.3389/fphar.2019.00359. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Chen Y, Li M, Qin F, Wang H. Research progress on chemical components and pharmacological effects of Zanthoxylum nitidum (Roxb.) DC. in recent five years. J. Guangxi Norm. Univ. (Nat. Sci. Ed.) 2023;41:24–37. [Google Scholar]
  • 16.He J, Wu X, Yan X, Sun S, Zhang F, Wang M, Xu Y, Li Y. Research progress on pharmacological effects of Liangmianzhen (Zanthoxyli Radix) based on efficacy and clinical application analysis. J. Liaoning Univ. TCM. 2023;25:93–97. [Google Scholar]
  • 17.Yu L, Huang B, Tan X, Guo B. Survey of wild germplasm of Zanthoxylum nitidum in Guangxi. Guangxi Zhiwu/Guihaia. 2009;29:231–284. [Google Scholar]
  • 18.Peng Z, Wu M, Xie Z, Yang X, Lai M. Investigation of wild resource of Zanthoxylum nitidum. Pharm. Today. 2018;28:500–504. [Google Scholar]
  • 19.Kalia RK, Rai MK, Kalia S, Singh R, Dhawan A. Microsatellite markers: An overview of the recent progress in plants. Euphytica. 2011;177:309–334. doi: 10.1007/s10681-010-0286-9. [DOI] [Google Scholar]
  • 20.Jiang M, Yan S, Ren W, Xing N, Li H, Zhang M, Liu M, Liu X, Ma W. Genetic diversity of the Chinese medicinal plant Astragali Radix based on transcriptome-derived SSR markers. Electron. J. Biotechnol. 2023;62:13–20. doi: 10.1016/j.ejbt.2022.12.001. [DOI] [Google Scholar]
  • 21.Zhang Z, Zhang J, Yang Q, Li B, Zhou W, Wang Z. Genome survey sequencing and genetic diversity of cultivated Akebia trifoliata assessed via phenotypes and SSR markers. Mol. Biol. Rep. 2021;48:241–250. doi: 10.1007/s11033-020-06042-w. [DOI] [PubMed] [Google Scholar]
  • 22.Gao X, Su Q, Yao B, Yang W, Ma W, Yang B, Liu C. Development of EST-SSR markers related to polyphyllin biosynthesis reveals genetic diversity and population structure in Paris polyphylla. Diversity. 2022;14:589. doi: 10.3390/d14080589. [DOI] [Google Scholar]
  • 23.Andolfatto P, Davison D, Erezyilmaz D, Hu TT, Mast J, Sunayama-Morita T, Stern DL. Multiplexed shotgun genotyping for rapid and efficient genetic mapping. Genome Res. 2011;21:610–617. doi: 10.1101/gr.115402.110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Chen S, Zhou Y, Chen Y, Gu J. fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatics. 2018;34:i884–i890. doi: 10.1093/bioinformatics/bty560. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Magoč T, Salzberg SL. FLASH: Fast length adjustment of short reads to improve genome assemblies. Bioinformatics. 2011;27:2957–2963. doi: 10.1093/bioinformatics/btr507. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Fu L, Niu B, Zhu Z, Wu S, Li W. CD-HIT: Accelerated for clustering the next-generation sequencing data. Bioinformatics. 2012;28:3150–3152. doi: 10.1093/bioinformatics/bts565. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Stajich JE, Block D, Boulez K, Brenner SE, Chervitz SA, Dagdigian C, Fuellen G, Gilbert JG, Korf I, Lapp H. The Bioperl toolkit: Perl modules for the life sciences. Genome Res. 2002;12:1611–1618. doi: 10.1101/gr.361602. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M, Rozen SG. Primer3—new capabilities and interfaces. Nucleic Acids Res. 2012;40:e115–e115. doi: 10.1093/nar/gks596. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Peakall R, Smouse PE. GENALEX 6: Genetic analysis in Excel. Population genetic software for teaching and research. Mol. Ecol. Notes. 2006;6:288–295. doi: 10.1111/j.1471-8286.2005.01155.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Shen J, Li Z, Chen J, Song Z, Zhou Z, Shi Y. SHEsisPlus, a toolset for genetic studies on polyploid species. Sci. Rep. 2016;6:24095. doi: 10.1038/srep24095. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Liu K, Muse SV. PowerMarker: An integrated analysis environment for genetic marker analysis. Bioinformatics. 2005;21:2128–2129. doi: 10.1093/bioinformatics/bti282. [DOI] [PubMed] [Google Scholar]
  • 32.Evanno G, Regnaut S, Goudet J. Detecting the number of clusters of individuals using the software STRUCTURE: A simulation study. Mol. Ecol. 2005;14:2611–2620. doi: 10.1111/j.1365-294X.2005.02553.x. [DOI] [PubMed] [Google Scholar]
  • 33.Yu Y-L, Wang H-C, Yu Z-X, Schinnerl J, Tang R, Geng Y-P, Chen G. Genetic diversity and structure of the endemic and endangered species Aristolochia delavayi growing along the Jinsha River. Plant Divers. 2021;43:225–233. doi: 10.1016/j.pld.2020.12.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Kumar R, Kumar C, Paliwal R, Roy Choudhury D, Singh I, Kumar A, Kumari A, Singh R. Development of novel genomic simple sequence repeat (g-SSR) markers and their validation for genetic diversity analyses in Kalmegh [Andrographis paniculata (Burm. F.) Nees] Plants. 2020;9:1734. doi: 10.3390/plants9121734. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Oliya, B. K. & Manandhar, L. Pant B: Genetic diversity and population structure analysis of Paris polyphylla Sm revealed by SSR marker (2022) [DOI] [PMC free article] [PubMed]
  • 36.Baird NA, Etter PD, Atwood TS, Currey MC, Shiver AL, Lewis ZA, Selker EU, Cresko WA, Johnson EA. Rapid SNP discovery and genetic mapping using sequenced RAD markers. PloS One. 2008;3:e3376. doi: 10.1371/journal.pone.0003376. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Huang X, Feng Q, Qian Q, Zhao Q, Wang L, Wang A, Guan J, Fan D, Weng Q, Huang T. High-throughput genotyping by whole-genome resequencing. Genome Res. 2009;19:1068–1076. doi: 10.1101/gr.089516.108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Botstein D, White RL, Skolnick M, Davis RW. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am. J. Human Genet. 1980;32:314. [PMC free article] [PubMed] [Google Scholar]
  • 39.Reddy SB, Rosenberg NA. Refining the relationship between homozygosity and the frequency of the most frequent allele. J. Math. Biol. 2012;64:87–108. doi: 10.1007/s00285-011-0406-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Spellerberg IF, Fedor PJ. A tribute to Claude Shannon (1916–2001) and a plea for more rigorous use of species richness, species diversity and the ‘Shannon–Wiener’Index. Glob. Ecol. Biogeogr. 2003;12:177–179. doi: 10.1046/j.1466-822X.2003.00015.x. [DOI] [Google Scholar]
  • 41.Wright S. Evolution and the Genetics of Populations, Volume 4: Variability Within and Among Natural Populations. University of Chicago Press; 1984. [Google Scholar]
  • 42.Govindaraju DR. Variation in gene flow levels among predominantly self-pollinated plants. J. Evolut. Biol. 1989;2:173–181. doi: 10.1046/j.1420-9101.1989.2030173.x. [DOI] [Google Scholar]
  • 43.Xiang Q, Huang X, Li H, Jiang S. ISSR analysis on genetic diversity of medically important Zanthoxylum nitidum (Roxb). DC. in Guangxi. Guangxi Sci. 2014;21:541–549. [Google Scholar]
  • 44.Feng S, Niu J, Liu Z, Tian L, Wang X, Wei A. Genetic diversity and evolutionary relationships of chinese pepper based on nrDNA markers. Forests. 2020;11:543. doi: 10.3390/f11050543. [DOI] [Google Scholar]
  • 45.Feng S, Yang T, Liu Z, Chen L, Hou N, Wang Y, Wei A. Genetic diversity and relationships of wild and cultivated Zanthoxylum germplasms based on sequence-related amplified polymorphism (SRAP) markers. Genet. Resour. Crop Evolut. 2015;62:1193–1204. doi: 10.1007/s10722-015-0222-x. [DOI] [Google Scholar]
  • 46.Luo Y, Zhang X, Xu J, Zheng Y, Pu S, Duan Z, Li Z, Liu G, Chen J, Wang Z. Phenotypic and molecular marker analysis uncovers the genetic diversity of the grass Stenotaphrum secundatum. BMC Genet. 2020;21:1–12. doi: 10.1186/s12863-020-00892-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Abdelsalam NR, Awad RM, Ali HM, Salem MZ, Abdellatif KF, Elshikh MS. Morphological, pomological, and specific molecular marker resources for genetic diversity analyses in fig (Ficus carica L.) HortScience. 2019;54:1299–1309. doi: 10.21273/HORTSCI14091-19. [DOI] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Table S1. (13.8KB, xlsx)
Supplementary Table S2. (145.1KB, xlsx)
Supplementary Table S3. (21.4KB, xlsx)
Supplementary Table S4. (39.9KB, xlsx)
Supplementary Table S5. (46.9KB, xlsx)
Supplementary Table S6. (28.7KB, xlsx)

Data Availability Statement

The data that support the findings of this study are available in the supplementary material of this article.


Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES