TABLE 1.
Plasmids used in the in vivo studies
| Plasmid | Size (bp) | Relevant property(-ies) in the ssoA region | Nucleotide sequence of the ssoA subregion (5′-3′)a | Reference or source |
|---|---|---|---|---|
| pLS1 | 4,408 | wt | CCGAAAGGCTTTAGCGTTTCGG | 16 |
| pLS1CM | 4,408 | Totally unpaired CS-6, 5-bp change that generates a weak consensus | CCGAAAGGCTTATCGATTTCGG | 14 |
| pLS1G1 | 4,408 | Totally unpaired CS-6, contains the wt CS-6 sequence | CCGAAAATATTTAGCGTTTCGG | This work |
| pLS1G3 | 4,408 | Total change of the CS-6 sequence, structure is similar to the wt | CCGAAGGATTTGGATCCTTCGG | This work |
| pLS1G4 | 4,408 | Totally unpaired and changed CS-6 | CCGAAGGGCTTGGATCCTTCGG | This work |
| pLS1G5 | 4,408 | RSB almost totally unpaired, maintains the wt sequence | GAAATATTAATAAb | This work |
| pLS1G6 | 4,411 | RSB totally paired, maintains the wt sequence | GCTTTCATGGCATAAc | This work |
| pLS1G7 | 4,408 | 6-bp change in the unpaired RSB sequence, structure is similar to the wt | CGATTTATGCCAGATCTGCTATTT | This work |
| pLS1G3G7 | 4,408 | Double mutant containing the G3 and G7 mutations | This work | |
| pLS1Δ13 | 4,267 | Deleted RSB, wt CS-6 sequence | 14 | |
| pLS1Δ14 | 4,202 | Deleted RSB, wt CS-6 sequence | 14 | |
| pLS1ΔNA | 4,209 | Deletion of the pLS1 AflII-NcoI small fragment, entire ssoA deleted | 14 | |
| pE194 | 3,728 | wt ssoA, homologous to pLS1-ssoA | 12 |
a
Changes introduced in the wt conserved CS-6 and RSB sequences are underlined, and changes introduced in the RSB complementary sequence are in boldface.
b
Complementary sequence of RSB modified to reduce base pairing.
c
Complementary sequence of RSB modified to increase base pairing.