Skip to main content
Animal Nutrition logoLink to Animal Nutrition
. 2023 Sep 9;15:430–442. doi: 10.1016/j.aninu.2023.08.009

Effects of xylanase, protease, and xylo-oligosaccharides on growth performance, nutrient utilization, short chain fatty acids, and microbiota in Eimeria-challenged broiler chickens fed high fiber diet

Yang Lin a,∗,1, Jeferson M Lourenco b, Oluyinka A Olukosi a
PMCID: PMC10686808  PMID: 38033611

Abstract

A 21-d experiment was conducted to study the effect of xylanase, protease, and xylo-oligosaccharides on growth performance, nutrient utilization, gene expression of nutrient transporters, cecal short-chain fatty acids (SCFA), and cecal microbiota profile of broilers challenged with mixed Eimeria spp. The study utilized 392 zero-d-old male broiler chicks allocated to 8 treatments in a 4 × 2 factorial arrangement, as follows: corn-soybean meal diet with no enzyme (Con); Con plus xylanase alone (XYL); Con plus xylanase combined with protease (XYL + PRO); or Con plus xylo-oligosaccharides (XOS); with or without Eimeria challenge. Diets were based on a high-fiber (100 g/kg soluble fibers and 14 g/kg insoluble fibers) basal diet. At d 15, birds in challenged treatment were gavaged with a solution containing Eimeria maxima, Eimeria acervulina, and Eimeria tenella oocysts. At d 21, birds were sampled. Eimeria depressed (P < 0.01) growth performance and nutrient utilization, whereas supplementation had no effect. There were significant Eimeria × supplementation interactions for the sugar transporters GLUT5 (P = 0.02), SGLT1 (P = 0.01), SGLT4 (P < 0.01), and peptide transporter PepT1 (P < 0.01) in jejunal mucosa. Eimeria challenge increased the expression of GM-CSF2 (P < 0.01) and IL-17 (P = 0.04) but decreased (P = 0.03) IL-1β expression in the cecal tonsil. Eimeria × supplementation interactions for cecal acetate, butyrate, and total SCFA showed that concentrations increased or tended to be greater in the supplemented treatments, but only in non-challenged birds. Birds challenged with Eimeria spp. had higher concentrations of isobutyrate (P < 0.01), isovalerate (P < 0.01), and valerate (P = 0.02) in cecal content. Eimeria challenge significantly (P < 0.01) decreased the microbial richness and diversity, and increased (P < 0.01) the proportion of Anaerostipes butyraticus, Bifidobacterium pseudolongum, and Lactobacillus pontis. In conclusion, Eimeria infection depressed growth performance, nutrient utilization with regulating nutrient transporters. Furthermore, Eimeria challenge shifted the microbial profile and reduced microbial richness and diversity. On the other hand, enzyme supplementation showed limited benefits, which included increased concentrations of SCFA.

Keywords: Eimeria, Xylanase, Protease, Xylo-oligosaccharides, Microbiome, Broiler chicken

1. Introduction

Avian coccidiosis is currently the most important parasitic disease and cause of losses in the poultry industry. A recent calculation shows that coccidiosis results in losses of $14.5 billion annually in worldwide chicken production, mainly due to depressed growth performance caused by subclinical infection and the cost of treatment and prevention (Blake et al., 2020). Eimeria acervulina, Eimeria maxima, and Eimeria tenella are the three most prevalent species, targeting the upper intestine (duodenum), middle intestine (jejunum and ileum), and ceca of chickens, respectively (Allen and Fetterer, 2002).

The control of coccidiosis has become more challenging because of the global drive to reduce the use of antibiotics in livestock production, mainly due to the concern about antibiotic resistance. Ionophore anticoccidials, such as monensin, were added to poultry feed for more than fifty years and played crucial roles in controlling coccidiosis (Chapman et al., 2010). However, characterized as antibiotics by the Food & Drug Administration, ionophore anticoccidials cannot be used in antibiotic-free poultry production (Cervantes, 2015). Feed additives have been one of the potential approaches to compensate for feed ionophore restrictions.

One important mechanism of action of feed enzymes is in hydrolyzing anti-nutrients such as non-starch polysaccharides, which exist in relative abundance in high-fiber feedstuffs; thus, it is reasonable to expect that carbohydrases would be more effective in high fiber diets (Kiarie et al., 2013). Feed enzymes and prebiotics may alleviate Eimeria-induced performance losses, and this suggestion is mainly based on the anticipated mechanism of action that exogenous enzymes and prebiotics can beneficially alter the gut microbial composition. Coccidiosis negatively influences the intestinal microbiome and induces dysbiosis (Macdonald et al., 2017; Madlala et al., 2021), which is partly due to the increased content of undigested nutrients such as amino acids in the hindgut due to malabsorption in the foregut (Amerah and Ravindran, 2014). Prebiotics cannot be digested by chickens' endogenous enzymes, and thus reach the hindgut where they are utilized by microbiota, selectively promoting the growth of the bacteria that are able to derive their nutrients from degrading the prebiotics (Pourabedin and Zhao, 2015). In addition, feed enzymes hydrolyze anti-nutrients and the products from enzyme hydrolysis may fuel growth of beneficial gut microbiota. Previous works have demonstrated that feed additives, including enzymes and prebiotics, have the ability to affect intestinal microbiota by increasing beneficial and inhibiting detrimental bacteria (Józefiak et al., 2007; Pourabedin and Zhao, 2015; Munyaka et al., 2016). It has been reported that dietary supplementation of xylo-oligosaccharides increased the population of Lactobacillus spp. and cecal acetate production in broiler chickens (Pourabedin and Zhao, 2015). The increased acetate during xylo-oligosaccharides fermentation stimulates butyrate-producing bacteria through cross-feeding interaction, thus increasing butyrate production (De Maesschalck et al., 2015). Xylanases are hydrolytic enzymes targeting polysaccharides xylan and release xylo-oligosaccharides from arabinoxylans, benefiting the growth of carbohydrate-utilizing bacteria (Morgan et al., 2020). However, the effects of xylanase or xylo-oligosaccharides on intestinal microbiota in Eimeria-challenged birds require further investigation.

The current study was conducted to investigate and compare the potential and possible mechanisms of action of xylanase and xylo-oligosaccharides in alleviating the pathogenic effects of coccidiosis infection on growth performance and gut health in broiler chickens. The high fiber diets used in the current experiment was intended to maximize the effect of xylanase and is based on our previous study (Lin and Olukosi, 2021a). Protease was added in one treatment to simulate the combined use of the enzymes in the industry.

2. Materials and methods

2.1. Animal ethics statement

The experiment was performed at the Poultry Research Center at the University of Georgia. The Institutional Animal Care and Use Committee of the University of Georgia approved (A2018 08-026) the procedures in the current study.

2.2. Birds, diets, experimental design and Eimeria challenge

The experiment utilized 392 zero-d-old Cobb 500 (off-sex) male broiler chicks. High-fiber corn-soybean meal diets (Table 1) were formulated with supplemental phytase at 500 FTU/kg (Quantum Blue, AB Vista, Marlborough, UK). Wheat and wheat bran were added to increase the dietary fiber level. Birds were allocated to eight treatments in a 4 × 2 factorial arrangement, seven replicate cages per treatment, and seven birds per replicate cage. One factor was diet supplementation: basal diet without supplementation (Con); basal diet with 0.1 g/kg xylanase (AB Vista, Marlborough, UK) (XYL); basal diet with 0.1 g/kg xylanase and 0.2 g/kg protease (DSM, Pendergrass, GA, USA) (XYL + PRO); and basal diet with 0.5 g/kg xylo-oligosaccharides (AIDP Inc., City of Industry, CA, USA) (XOS). The other factor was the presence or not of the Eimeria challenge. The protease and xylanase were produced from the fermentation of sporulation-deficient Bacillus licheniformis strain (Kalmendal and Tauson, 2012) and genetically modified Trichoderma reesei (Lin and Olukosi, 2021a), respectively. The xylo-oligosaccharides was obtained from non-genetically modified corn and was previously characterized (Silva et al., 2020, Yang et al., 2015). The Eimeria spp. oocysts were a mixed-species solution including 12,500 oocysts/mL of E. maxima, 12,500 oocysts/mL of E. tenella, and 62,500 oocysts/mL of E. acervuline for a mild infection as previously described (Teng et al., 2020).

Table 1.

Ingredients (as-fed basis), calculated and analyzed compositions (dry matter basis) of the experimental control diet.

Item Content, g/kg
Ingredients
Corn 339.7
Wheat 200.0
Wheat bran 100.0
Soybean meal 315.0
Soybean oil 13.0
Titanium dioxide 5.0
Di-calcium phosphate 8.0
Limestone 10.0
Lysine 1.2
Methionine 1.5
Threonine 0.2
NaHCO3 0.8
Salt 3.0
Vitamin premix1 1.25
Trace minerals premix2 1.25
Phytase 0.1
Total 1000
Calculated nutrients and energy
Crude protein 216
Metabolizable energy, kcal/kg 2804
Ca 7.2
Total P 6.4
Available P3 3.0
Met 4.8
Cys 3.5
Met + Cys 8.4
Lys 12.3
His 5.7
Trp 2.9
Thr 8.4
Arg 14.3
Analyzed composition
Dry matter 895
Crude protein 221
Gross energy, kcal/kg 4027
Neutral detergent fiber 113
Acid detergent fiber 50
Insoluble fiber 100
Soluble fiber 14
Hemicellulose 63
Ca 7.47
Total P 6.27
1

Supplemented per kilogram of diet: vitamin A, 5484 IU; vitamin D3, 2643 IU; vitamin E, 11 IU; menadione sodium bisulfite, 4.38 mg; riboflavin, 5.49 mg, D-pantothenic acid, 11 mg; niacin, 44.1 mg, choline chloride, 771 mg; vitamin B12, 13.2 μg; biotin, 55.2 μg; thiamine mononitrate, 2.2 mg; folic acid, 990 μg; pyridoxine hydrochloride, 3.3 mg.

2

Supplemented per kilogram of diet: iodine, 1.11 mg; manganese, 66.06 mg; copper, 4.44 mg; iron, 44.1 mg; zinc, 44.1 mg; selenium, 300 μg.

3

Available P level included the matrix for the phytase.

On d 15, birds were gavaged with 1 mL mixed-species Eimeria oocysts solution or 1 mL water based on the treatments. In order to get blank blood samples as the standard reference for the gut permeability test, ten extra birds were raised (receiving basal diet) in a separate cage. The chickens were raised under temperature and lighting regimes based on the recommendation for Cobb 500. Tap water and feed were provided ad libitum.

2.3. Growth performance, intestinal permeability

Body weight gain (WG), feed intake (FI), and gain:feed ratio were measured and calculated from d 0 to 15 (pre-challenge phase) and d 15 to 21 (challenge phase).

An intestinal permeability test was performed on 5 d post-challenge at d 20 as described previously (Teng et al., 2020). At d 20 (5 d post-challenge), one bird from each challenged cage and unchallenged Con treatment were orally administrated with 1 mL of freshly prepared fluorescein isothiocyanate dextran (FITC-d, MW 4,000; Sigma–Aldrich, CA) solution (2.2 mg/mL). After 2 h of the administration, blood was collected from the birds' heart following cervical dislocation. Blank blood samples from extra birds were collected to dilute FITC-d for the standard curve preparation. Clotted blood was centrifuged at 1,000 × g for 12 min to separate serum, and the FITC-d concentration in serum was measured by spectrophotometer (Spectramax M5, Molecular Devices, San Jose, CA) at 485 nm excitation wavelength and 528 nm emission wavelength. A dark environment was used for the FITC-d procedures to avoid photolysis.

2.4. Sample collection

The excreta voided within 24 h from individual cages were collected at d 20 (5 d post-challenge) and oven-dried, ground, and later used for nutrient utilization measurements, including total tract retention of N. At d 21 (6 d post-challenge), 5 birds per cage were euthanized by carbon dioxide asphyxiation. Ileal digesta were collected from the 5 birds per cage and oven-dried for ileal digestibility measurement. Cecal contents were collected from 3 birds and stored at −20 °C for further analysis of short-chain fatty acids (SCFA), cecal protein and microbiota analysis. Jejunal mucosa and cecal tonsil were collected from 2 birds, snap-frozen in liquid nitrogen immediately and stored at −80 °C before further gene expression analysis. Three birds were used to score intestinal lesions based on a 0 to 4 (no lesion to severe lesion) scale grading. The upper (duodenum), middle (jejunum and ileum), and ceca sections of the digestive tract were scored separately (Johnson and Reid, 1970).

2.5. Oocyst shedding

Excreta voided within 24 h at d 21 (6 d post-challenge) were collected quantitatively from each cage and stored at 4 °C for further oocyst shedding measurement. After thorough mixing, approximately 5 g excreta samples from each cage were diluted with water in a 1:99 ratio. After the mixture was vortexed, 5 mL of diluted samples were mixed with 45 mL of saturated salt solution in a centrifuge tube. The mixture was vortexed again and the samples were thereafter loaded into a McMaster chamber and the number of oocysts was counted under a microscope.

2.6. Quantitative real-time PCR and 16S rRNA gene sequencing analysis

The mRNA quantities of target intestinal nutrient transporters in jejunum mucosa and immune-related genes in the cecal tonsil were analyzed using real-time PCR. Samples of jejunum mucosa or cecal tonsil were homogenized with QiAzol lysis reagent (QIAGEN, Hilden, North Rhine-Westphalia, Germany). The total RNA was extracted after homogenization according to the manufacturer's instructions. RNA quantity was measured by BioTek Synergy HTX spectrophotometer (Agilent, Santa Clara, CA, USA) and diluted to equal concentration. Extracted RNA was converted to cDNA by a high-capacity cDNA reverse transcription kit (Thermo Fisher Scientific, Waltham, MA, USA). The real-time PCR reaction was performed in Step One Plus real-time PCR system (Thermo Fisher Scientific, Waltham, MA, USA) with SYBR Green Supermix (Bio-Rad, Hercules, CA, USA). Samples were run in duplicate, and the results were analyzed using the 2ΔΔCt method (Livak and Schmittgen, 2001). Primers used in the experiment are listed in Table 2.

Table 2.

List of primers used for qPCR.

Gene symbol Accession number Full name Function Forward primer (5′to 3′) Reverse primer (5′to 3′)
18S MG967540.1 18S ribosomal RNA Housekeeping gene AGCCTGCGGCTTAATTTGAC CAACTAAGAACGGCCATGCA
Beta-actin NM_205518.1 Beta-actin Housekeeping gene CAACACAGTGCTGTCTGGTGGTA ATCGTACTCCTGCTTGCTGATCC
GAPGH NM_204305.2 Glyceraldehyde-3-phosphate dehydrogenase Housekeeping gene GAGGGTAGTGAAGGCTGCTG CCACAACACGGTTGCTGTAT
PepT1 (SLC15A1) KF366603.1 Peptide transporter 1 Peptide transporter CCCCTGAGGAGGATCACTGTT CAAAAGAGCAGCAGCAACGA
GLUT1 (SLC2A1) NM_205209.1 Glucose transporter 1 Glucose transporter CTTTGTCAACCGCTTTGG CAGAATACAGGCCGATGAT
GLUT5 (SLC2A5) XR_005855627.1 Glucose transporter 5 Glucose transporter TTGCTGGCTTTGGGTTGTG GGAGGTTGAGGGCCAAAGTC
SGLT1 (SLC5A1) NM_001293240.1 Sodium glucose transporter 1 Glucose transporter GCCGTGGCCAGGGCTTA CAATAACCTGATCTGTGCACCAGT
SGLT4 (SLC5A9) XM_040678521.2 Sodium glucose transporter 4 Glucose transporter ATACCCAAGGTAATAGTCCCAAAC TGGGTCCCTGAACAAATGAAA
ATP2B1 XM_046906440.1 ATPase plasma membrane Ca2+ transporting 1 Ca2+ transporter TTAATGCCCGGAAAATTCAC TCCACCAAACTGCACGATAA
CaSR XM_040661543.2 Calcium sensing receptor Calcium receptor GCCAATCTGCTGGGACTCTT CTGATGCTCGTCATTGGGGA
GM-CSF2 NM_001007078.2 Granulocyte-macrophage stimulating factor 2 Colony stimulating factor CGCCCACCACAACATACTC ACGATTCCGCTTTCTTCCT
IFN-ϒ XM_031589614.1 Interferon-gamma Macrophages primary activator AGCTGACGGTGGACCTATTATT GGCTTTGCGCTGGATTC
TGF-β1 XM_046937641.1 Transforming growth factor beta 1 Transforming growth factor CGGGACGGATGAGAAGAAC CGGCCCACGTAGTAAATGAT
IL-3 NM_001007083.2 Interleukin 3 Interleukins CTCTGCCTGCTGCTGTCC TTATCTGCTTTTTGCTGCTTTC
IL-1β XM_026043102.1 Interleukin 1β Interleukins TGGGCATCAAGGGCTACA TCGGGTTGGTTGGTGATG
IL-15 XM_046915461.1 Interleukin 15 Interleukins TCTGTTCTTCTGTTCTGAGTGATG AGTGATTTGCTTCTGTCTTTGGTA
IL-17 HM747027.1 Interleukin 17 Interleukins CTCCGATCCCTTATTCTCCTC AAGCGGTTGTGGTCCTCAT

QIAamp PowerFecal Pro DNA Kit (QIAGEN, Germantown, TN, USA) was used to extract the DNA from the cecal contents using a procedure combining mechanical and chemical methods, following the instructions of the manufacturer. DNA samples were sent to LC Sciences, LLC (Houston, TX, USA) for library preparation and 16S rRNA gene sequencing. Forward primer S-D-Bact-0341-b-S-17 (5′-CCTACGGGNGGCWGCAG-3′) and reverse primer S-D-Bact-0785-a-A-21 (5′-GACTACHVGGGTATCTAATCC-3′) were used for PCR libraries. The Qiime2 was used for DNA sequence data analysis following previously described procedures (Akerele et al., 2022).

2.7. Chemical analysis

Oven-dried diets, excreta, and ileal digesta were ground through a 0.5-mm sieve to determine dry matter (DM) (Method 934.01, AOAC, 2006), N, gross energy (GE), and titanium dioxide. The determination of DM was achieved through the process of drying the samples in an oven at 100 °C for 24 h. Nitrogen concentration in the diets, ileal digesta, and excreta were determined using the combustion method (LECO, St. Joseph, MI, USA). Acid detergent fiber (ADF) was measured in the residue remaining after digesting with H2SO4 and hexadecyltrimethylammonium bromide (CTAB). Neutral detergent fiber (NDF) in diets was measured in the residue remaining after digesting in a detergent solution. The Ankom A200 Fiber Analyzer (Ankom Technology, Macedon, NY, USA) was used to measure ADF and NDF. Insoluble and soluble dietary fibers were measured by the Ankom TDF analyzer (Ankom Technology, Macedon, NY, USA) based on the AOAC method 991.43. Hemicellulose content was calculated as the difference between NDF and ADF quantities. Titanium concentration was determined according to the method of Short et al. (1996). Xylanase activity was analyzed by AB Vista analytical service with an enzyme-linked immunosorbent assay technology-based method (AB Vista, Plantation, FL, USA). Protease activity was analyzed by DSM technical analytical services. Diet oligosaccharides including (Hex)3-6 and (Pen)3-6 in diets were analyzed at the complex carbohydrate research center at the University of Georgia with matrix-assisted laser desorption ionization mass spectrometry (MALDI-MS) as previously described (Lin and Olukosi, 2021a).

In addition, diets and excreta samples were sent to the Central Analytical Laboratory of University of Arkansas for the measurement of gross energy and mineral profile. The determination of gross energy was carried out by utilizing an isoperibol bomb calorimeter (Model 6200, Parr Instruments, Moline, IL, US), with benzoic acid serving as the calibration standard. The determination of minerals was done using Spectro Analytical Instruments (Arcos OES ICP, Kleve, North Rhine-Westphalia, Germany) (method 968.08, AOAC), modified to use inductively-coupled plasma.

Cecal SCFA composition was analyzed by gas chromatography according to the previously described method (Lourenco et al., 2020). The cecal content sample (1 g) was diluted in 3 mL deionized water and centrifuged for 10 min at 10,000 × g. The resulting supernatant was combined with 25% meta-phosphoric acid, then frozen overnight before being thawed and mixed with ethyl acetate in a 1:2 ratio. After vortexing and settling, the uppermost layer of the mixture was transferred to a glass vial and analyzed via gas chromatograph.

2.8. Calculations and statistical analysis

The following index method equation was used to calculate total tract retention and apparent ileal digestibility of energy, DM, and crude protein:

Digestibility=100×1CiCo×NoNi,

where Ci is the concentration of titanium in the diet, Ni is the nutrient content in the diet, Co is the concentration of titanium in excreta or digesta, and No is the nutrient content in excreta or ileal digesta.

Apparent metabolizable energy (AME) was calculated by the following equation:

AME=GEiCiCo×GEo,

where GEi is the gross energy of the diet, and GEo is the gross energy of the excreta.

The mixed model procedure of JMP Pro 14.1.0 (SAS Institute Inc., Cary, NC, USA) was utilized for statistical analysis, as appropriate for a randomized complete block design and a factorial treatment arrangement. Except for lesion scores and microbiota data, two-way ANOVA was used for statistical analysis. The two factors were the Eimeria challenge (2 levels) and supplementations (4 levels). Means were separated using Tukey's honest significant difference test in case of a significant interaction. Intestinal lesion score, alpha diversity indices, relative bacterial richness, and comparisons of microbial composition between treatments were analyzed by Kruskal–Wallis nonparametric statistical method. Statistical significance was set at P ≤ 0.05, and trends were set at P ≤ 0.10.

3. Results and discussion

3.1. Diets, growth performance and nutrient utilization

The calculated and analyzed composition of diets are presented in Table 1. The xylanase activities were 17,400 and 15,800 active units in the XYL and XYL + PRO diets, respectively. The protease activity was 20,376 active units in the XYL + PRO diet. The total oligosaccharides including (Hex)3-6 and (Pent)3-6 are 53.9 μg/mg in the Con diet and 2055 μg/mg in the xylo-oligosaccharides supplemented diet.

There was no significant Eimeria × supplementation interaction on growth performance (Table 3). In the post-challenge phase, the Eimeria challenge significantly (P < 0.01) decreased WG, FI, and gain:feed ratio. There was no significant (P < 0.01) Eimeria × supplementation interaction on nutrient utilization (Table 4). Eimeria challenge significantly (P < 0.01) lowered ileal DM (−17.9 pp) and N (−21.2 pp), and also depressed (P < 0.01) AME and total tract retention of N. However, the supplements had no effects on growth performance or nutrient utilization.

Table 3.

Growth performance of the broiler chickens challenged or unchallenged with mixed Eimeria spp. in response to dietary supplementations.1

Treatment Eimeria Supplementation Pre-challenge phase (d 0 to 15)
Challenge phase (d 15 to 21)
WG, g/bird FI, g/bird Gain:Feed, g/kg WG, g/bird FI, g/bird Gain:Feed, g/kg
1 Con 393 537 707 359 443 809
2 XYL 402 573 702 396 471 841
3 XYL + PRO 395 573 690 407 478 850
4 XOS 402 598 676 391 475 835
5 + Con 384 550 696 228 360 634
6 + XYL 406 575 705 230 364 631
7 + XYL + PRO 424 580 731 229 365 627
8 + XOS 384 550 696 228 360 634
Pooled SEM 13.9 19.3 13.8 10.9 11.1 25.1
Means for main effect of Eimeria challenge
388 467 834
+ 228 363 627
Pooled SEM 5.4 5.6 12.5
P-values of Eimeria challenge < 0.001 < 0.001 < 0.001
Means for main effect of supplementations
Con 389 544 701 294 401 722
XYL 404 574 704 313 418 736
XYL+PRO 410 576 711 318 422 739
XOS 411 580 713 307 419 725
Pooled SEM 9.8 13.7 9.8 7.7 7.9 17.7
P-values of supplementations 0.332 0.166 0.846 0.499 0.499 0.635
P-values for interactions 0.608 0.608 0.687

WG = weight gain; FI = feed intake; Con = no supplementation; XYL = xylanase; XYL + PRO = xylanase and protease; XOS = xylo-oligosaccharides.

1

n = 7 replicates for the simple effect; n = 28 replicates for the main effects of Eimeria challenge; n = 14 replicates for the main effects of each supplementation.

Table 4.

Total tract nutrient retention and ileal digestibility (%, dry matter) for the broiler chickens challenged or unchallenged with mixed Eimeria spp. in response to dietary supplementations.1

Treatment Eimeria Supplementation Ileal digestibility
Total tract retention
DM Nitrogen Nitrogen AME, kcal/kg
1 Con 67.2 82.9 62.5 2654
2 XYL 68.7 79.9 62.5 2707
3 XYL + PRO 67.8 79.2 62.6 2725
4 XOS 65.2 78.2 61.0 2599
5 + Con 51.0 60.4 24.0 1457
6 + XYL 52.1 57.2 28.3 1710
7 + XYL + PRO 50.3 58.9 28.1 1550
8 + XOS 43.8 59.3 28.5 1576
Pooled SEM 3.39 3.36 3.61 92.2
Means for main effect of Eimeria challenge
67.2 80.1 62.2 2671
+ 49.3 58.9 27.2 1574
Pooled SEM 1.40 3.15 1.54 38.3
P-values for main effect of Eimeria challenge <0.001 <0.001 <0.001 <0.001
Means for main effect of supplementations
Con 59.1 71.7 43.2 2056
XYL 60.4 68.6 45.4 2209
XYL + PRO 59.1 69.1 45.4 2138
XOS 54.5 68.8 44.8 2087
Pooled SEM 2.07 1.97 1.86 44.8
P-values for main effect of supplementations 0.342 0.793 0.831 1.089
P-values for interactions 0.867 0.947 0.646 0.410

Con = no supplementation; XYL = xylanase; XYL + PRO = xylanase and protease; XOS = xylo-oligosaccharides; AME = apparent metabolizable energy; DM = dry matter.

1

n = 7 replicates for the simple effect; n = 28 replicates for the main effects of Eimeria challenge; n = 14 replicates for the main effects of each supplementation.

When used individually or combined, the effects of exogenous xylanase, protease, and xylo-oligosaccharides on improving the growth and nutrient digestibility of non-challenged chickens have been widely demonstrated (Kalmendal and Tauson, 2012; De Maesschalck et al., 2015; Craig et al., 2020b). Mechanisms by which xylanase improves the growth performance have been described in the literature. Firstly, xylanase releases trapped nutrients by hydrolyzing the cell wall, increasing available nutrients for absorption (Annison, 1992). Secondly, xylanase hydrolyzes xylans and reduces the digesta viscosity, improving digestion efficiency (Lee et al., 2017). Thirdly, xylo-oligosaccharides, a xylan hydrolysis by-product, acts as a prebiotic which improves nutrient utilization by modulating gut microflora and SCFA profiles (Bedford and Partridge, 2022). The combination of protease and carbohydrases is widely reported in feed additive studies, however, the comparison between individual carbohydrase and combined with protease is not well documented. Kalmendal and Tauson (2012) noted that supplemental xylanase and protease improved the feed conversion, whereas the combination of the two enzymes was not superior to those supplied individually. The literature has shown that the scale of beneficial responses to xylanase and protease is widely variable, depending on ingredient and nutrient factors. In our previous study (Lin and Olukosi, 2021a), birds receiving diets rich in fibrous feedstuffs along with xylanase supplementation produce higher levels of digesta oligosaccharides and cecal SCFA, indicating that fibers maximize the beneficial effects of xylanase, by providing greater enzymatic hydrolysis products. Moreover, the physicochemical properties of the fiber source play a critical role in xylanase efficacy. Xylanase perform better at digesting arabinoxylans in soluble but not insoluble fiber fraction (Hilhorst et al., 2002). Therefore, although similar fiber levels may be used, the differences in soluble fiber composition can be one of the factors causing variable xylanase responses. The diet analysis in this study showed a compraratively low soluble fiber content, which may partly explain the lack of growth performance and nutrient utilization responses to xylanase supplementation in the current study.

It has been demonstrated that the addition of xylanase, amylase, and protease provided a more pronounced improvement in feed conversion when chickens were fed high-fiber diets compared with low-fiber diets (Singh et al., 2017). Similarly, the effect of protease could be more observable in a diet with a high concentration of proteinaceous anti-nutrients such as trypsin inhibitors (Wedekind et al., 2020; Bedford and Partridge, 2022). Therefore, the variable effectiveness of the feed additives in the literature on growth performance and nutrient utilization may be partly explained by the possible insufficiency of anti-nutrients in the basal diet. In addition, Eimeria infection may be a factor influencing their effectiveness. Craig et al. (2020b) reported that xylo-oligosaccharides improved body weight gain in Eimeria-challenged broiler chickens (a vaccine model was used in the study). The efficacy of enzymes or prebiotics on growth performance and nutrient utilization under the disease model has not been consistently demonstrated (Craig et al., 2020a; Lin et al., 2022).

3.2. Intestinal permeability, lesion scores, and oocyst shedding

The gastrointestinal permeability response on d 20 (5 d post-challenge) is shown in Fig. 1. Birds challenged with mixed Eimeria spp. showed significantly (P < 0.01) higher serum FITC-d levels, whereas supplementations had no significant effect on intestinal permeability. Fig. 2 shows the results of intestinal lesion scores. Supplementations had no significant effect on intestinal lesion scores. E. acervulina, E. maxima, and E. tenella produced intestinal lesions in the upper intestine, middle intestine, and ceca, respectively. As shown in Fig. 3, oocysts were observed in the excreta samples from all Eimeria-challenged treatments, whereas supplementations had no effect on oocyst numbers.

Fig. 1.

Fig. 1

Fluorescein isothiocyanate dextran concentration (FITC-d, μg/mL) in serum of Eimeria-challenged broiler chickens in response to dietary supplementations (5 d post-challenge). n = 7. Con/− = unchallenged and no feed additives; Con/+ = challenged and no supplementation; XYL/+ = challenged and supplemented with xylanase treatment; XYL + PRO/+ = challenged and supplemented with xylanase and protease; XOS/+ = challenged and supplemented with xylo-oligosaccharides. The error bars represent the SEM values. Bars with different superscripts are significantly different (P < 0.05).

Fig. 2.

Fig. 2

Lesion scores in the upper intestine, middle intestine, and ceca of Eimeria-challenged broiler chicken in response to dietary supplementations (6 d post-challenge). Average scores of each treatment are present at the top of the bar. (A) Upper-intestine; (B) middle-intestine; (C) ceca. n = 7. Con/+ = challenged and no feed additives; XYL/+ = challenged and supplemented with xylanase; XYL + PRO/+ = challenged and supplemented with xylanase and protease; XOS/+ = challenged and supplemented with xylo-oligosaccharides treatment.

Fig. 3.

Fig. 3

Oocyst shedding (oocysts/g) of Eimeria-challenged broiler chickens in response to dietary supplementations (6 d post-challenge). n = 7. Con/+ = challenged and no feed additives; XYL/+ = challenged and supplemented with xylanase; XYL + PRO/+ = challenged and supplemented with xylanase and protease; XOS/+ = challenged and supplemented with xylo-oligosaccharides treatment. The error bars represent the SEM values.

Similar to the current study, previous studies have reported that Eimeria-caused lesions and oocyst shedding are unaffected by protease (Peek et al., 2009), xylanase, β-glucanase and xylo-oligosaccharides (Craig et al., 2020a). In contrast, Bozkurt et al. (2014) reported the combination of xylanase, amylase, protease, cellulose, β-glucanase, and mannanase, or the individual addition of mannan-oligosaccharides reduced lesion scores but had no effect on oocyst shedding. More studies with the individual rather than combined products should be done to further determine the effects of feed enzymes or prebiotics on oocyst shedding and lesion severity.

3.3. Gene expression of nutrients transporters and immune related genes

The expression of nutrient transporters in the jejunum mucosa in response to the Eimeria challenge and feed additives is shown in Table 5. There were significant Eimeria × supplementations interactions for sugar transporters glucose transporter 5 (GLUT5) (P = 0.02), sodium glucose transporter 1 (SGLT1) (P = 0.01), and sodium glucose transporter 4 (SGLT4) (P < 0.01), and peptide transporter 1 (PepT1) (P < 0.01). All the additives produced downward (P < 0.01) expression of GLUT5 and PepT1 in unchallenged treatments but had no effect in challenged treatments. SGLT1 expression was numerically highest in the unchallenged with XOS treatment and lowest in the challenged with XYL treatment. In addition, the Eimeria challenge produced downward (P < 0.01) expression of the glucose transporter type 1 (GLUT1), Ca transporter ATPase plasma membrane Ca2+ transporting 1 (ATP2B1), and Ca sensing receptor (CaSR), whereas feed additives had no effect.

Table 5.

Effects of mixed Eimeria spp. infection and supplementation on relative gene expression of nutrient transporters in the jejunum mucosa of broiler chickens on 6 d post-challenge.1

Treatment Eimeria Supplementation GLUT1 GLUT5 SGLT1 SGLT4 PepT1 ATP2B1 CaSR
1 Con 1.000 1.000a 1.000ab 1.000ab 1.000a 1.000 1.000
2 XYL 0.999 0.523b 1.176ab 0.676ab 0.385b 1.150 1.785
3 XYL + PRO 0.891 0.628b 0.712ab 0.700ab 0.410b 1.819 0.769
4 XOS 1.538 0.597b 1.221a 0.626ab 0.519b 1.401 0.875
5 + Con 0.262 0.329b 0.819ab 0.814ab 0.335b 0.706 0.489
6 + XYL 0.243 0.262b 0.571b 0.585b 0.312b 0.707 0.305
7 + XYL + PRO 0.309 0.340b 0.942ab 1.125a 0.313b 0.827 0.488
8 + XOS 0.337 0.293b 0.873ab 1.005ab 0.265b 0.774 0.398
Pooled SEM 0.0571 0.0103 0.0514 0.0232 0.0050 0.0952 0.1122
Means for main effect of Eimeria challenge
1.107 0.687 1.027 0.750 0.578 1.342 1.107
+ 0.288 0.306 0.801 0.882 0.306 0.754 0.420
Pooled SEM 0.0503 0.1241 0.0829 0.0360 0.0255 0.0937 0.1163
P-values for main effect of Eimeria challenge <0.001 <0.001 0.042 0.190 <0.001 <0.001 <0.001
Means for main effect of supplementations
Con 0.631 0.665 0.910 0.907 0.668 0.853 0.745
XYL 0.600 0.484 0.827 0.912 0.361 1.323 0.629
XYL + PRO 0.621 0.392 0.873 0.630 0.349 0.929 1.045
XOS 0.937 0.445 1.047 0.816 0.392 1.087 0.637
Pooled SEM 0.1232 0.0511 0.1030 0.0754 0.0340 0.1539 0.1746
P-values for main effect of supplementations 0.320 0.022 0.482 0.047 <0.001 0.130 0.525
P-values for interactions 0.390 0.023 0.010 <0.001 <0.001 0.793 0.215

Con = no supplementation; XYL = xylanase; XYL + PRO = xylanase and protease; XOS = xylo-oligosaccharides; GLUT1 = glucose transporter 1; GLUT5 = glucose transporter 5; SGLT1 = sodium glucose transporter 1; SGLT4 = sodium glucose transporter 4; PepT1 = peptide transporter 1; ATP2B1 = ATPase plasma membrane Ca2+ transporting 1; CaSR = calcium sensing receptor.

Means along a column with different superscripts are significantly different (P < 0.05).

1

n = 7 replicates for the simple effect; n = 28 replicates for the main effects of Eimeria challenge; n = 14 replicates for the main effects of each supplementation.

Consistent with the current study, the effect of Eimeria on downregulating nutrient transporters has been demonstrated and has been attributed to epithelial cell apoptosis and nutrient malabsorption (Su et al., 2014, 2015). It has been speculated that Eimeria infection downregulates nutrient transporters in the brush border such as GLUT5 and SGLT1. Thus fewer nutrients are transported to epithelial cells, inducing nutritional depletion and apoptosis in epithelial cells (Paris and Wong, 2013; Su et al., 2014, 2015). Therefore, our observation regarding the effect of Eimeria challenge is not unexpected. In addition, similar observations of additive-supplemented diets in unchallenged treatments have been demonstrated in previous works. In agreement with the current study, individual xylanase, the combination of xylanase and protease or the individual xylo-oligosaccharides have been shown to downregulate the expressions of jejunal sugar transporters (GLUT2 and GLUT5) and PepT1 in unchallenged treatments but not in challenged treatments (Guo et al., 2014; Lin and Olukosi, 2021b; Lin et al., 2022). The mRNA response to feed additives can be inhibited by the damage in epithelial cells caused by Eimeria infection. Feed additive-induced SCFA increase may play an important role in lowering the expression of GLUT2 and GLUT5. It has been demonstrated that elevated fatty acids concentration could reduce the expression of sugar transporters such as GLUT2 (Gremlich et al., 1997). In addition, xylo-oligosaccharides improves mineral absorption including Ca by releasing minerals from the indigestible mineral complexes facilitated by lowering intestinal pH with increased SCFA (Lin et al., 2023; Scholz-Ahrens et al., 2001). It should be noted that the improved mineral absorption mainly takes place in ceca where SCFA are produced from microbial fermentation (Józefiak et al., 2004), explaining the lack of response on intestinal Ca transporter CaSR in this study, where the Ca transporter CaSR mRNA was measured in jejunal mucosa (Weaver, 2015).

Table 6 shows the effects of Eimeria infection and feed additives on immune-related gene expression in ceca tonsils. Additives supplementation had no effect on the probed genes. Eimeria challenge increased the expression of granulocyte-macrophage colony-stimulating factor GM-CSF2 (P < 0.01) and interleukin (IL)-17 (P = 0.04) but decreased (P = 0.03) IL-1β expression. Eimeria infection causes a strong immunogenic response in chickens. Bursectomy-treated chickens still show resistance to Eimeria reinfection, indicating the minimal function of antibodies to defend against coccidiosis (Rose and Long, 1970; Lillehoj, 1987). On the other hand, the protective immunity in response to the Eimeria challenge is mainly composed of cell-mediated immunity, including specific and nonspecific T lymphocytes and macrophages, with secreted cytokines and pro-inflammatory molecules (Dalloul and Lillehoj, 2006). The role of IL-17 which is elevated by Eimeria infection in this study has been highlighted in previous chicken coccidiosis studies. Produced by Th 17 CD4+ T cells, increased IL-17 contributes to improving protective immunity against coccidiosis (Min et al., 2013). IL-17 stimulates the production of cytokines and chemokines such as IL-6, IL-8, and GM-CSF2, which is consistent with the upregulated expression of GM-CSF2 in the current study (Pappu et al., 2012). GM-CSF2 is a Th2 cytokine shown to reduce the production of pro-inflammatory cytokines, inhibiting inflammatory responses (Hong et al., 2006). Therefore, the increase of GM-CSF2 and IL-17 is important for immunocompetence in chickens.

Table 6.

Effects of mixed Eimeria spp. infection and supplementation on relative gene expression of immune response in ceca tonsils of broiler chickens on 6 d post-challenge.1

Treatment Eimeria Supplementation GM-CSF2 IFN-ϒ TGF-β1 IL-3 IL-1β IL-15 IL-17
1 Con 1.000 1.000 1.000 1.000 1.000 1.000 1.000
2 XYL 0.628 0.830 1.040 0.597 0.708 0.821 0.984
3 XYL + PRO 0.409 0.518 0.823 0.692 0.709 0.751 0.753
4 XOS 0.715 0.622 0.763 0.646 0.953 0.927 0.836
5 + Con 1.892 1.106 0.637 0.735 0.723 0.965 2.114
6 + XYL 1.362 0.891 0.733 0.670 0.792 1.171 1.181
7 + XYL + PRO 1.709 0.989 0.493 0.594 0.730 1.176 0.783
8 + XOS 1.134 0.592 1.048 0.685 0.644 1.310 1.384
Pooled SEM 0.0832 0.0421 0.0441 0.0280 0.0436 0.0654 0.3401
Means for main effect of Eimeria challenge
0.688 0.743 0.906 0.734 0.842 0.875 0.893
+ 1.524 0.894 0.728 0.671 0.722 1.156 1.366
Pooled SEM 0.0920 0.0710 0.0712 0.0593 0.0365 0.0859 0.1315
P-values for main effect of Eimeria challenge <0.001 0.255 0.517 0.586 0.028 0.100 0.038
Means for main effect of supplementations
Con 1.446 1.053 0.819 0.867 0.861 0.982 1.557
XYL 0.995 0.861 0.886 0.633 0.750 0.996 1.083
XYL + PRO 1.059 0.753 0.658 0.643 0.719 0.964 0.768
XOS 0.925 0.607 0.905 0.666 0.798 1.119 1.110
Pooled SEM 0.1543 0.1083 0.1090 0.0892 0.1036 0.1111 0.3002
P-values for main effect of supplementations 0.180 0.100 0.517 0.339 0.898 0.762 0.477
P-values for interactions 0.326 0.517 0.235 0.639 0.796 0.575 0.644

Con = no supplementation; XYL = xylanase; XYL + PRO = xylanase and protease; XOS = xylo-oligosaccharides; GM-CSF2 = granulocyte-macrophage stimulating factor 2; IFN = interferon; TGF = transforming growth factor; IL = interleukin.

1

n = 7 replicates for the simple effect; n = 28 replicates for the main effects of Eimeria challenge; n = 14 replicates for the main effects of each supplementation.

3.4. Cecal short chain fatty acids profile and protein concentration

The cecal short-chain fatty acids profile is shown in Table 7. The Eimeria × supplementations interaction for cecal butyrate showed that butyrate concentrations numerically increased in the supplemented treatments, but only in non-challenged birds. In addition, birds challenged with Eimeria spp. had higher concentrations of isobutyrate (P < 0.01), isovalerate (P < 0.01), and valerate (P = 0.02). Due to the infection, malabsorption and enteritis may occur in the chicken intestine, resulting in a significant shift in digesta substrates available for microbial fermentation as well as metabolites produced. Apart from propionate, SCFA concentrations influenced by Eimeria infection in this study were consistent with the literature. It has been shown that Eimeria infection decreased the concentration of SCFA produced from carbohydrate fermentation, such as acetate and butyrate, but increased the concentration of branched-chain fatty acids (BCFA), such as isobutyrate and isovalerate fermented from protein substrate (Lin and Olukosi, 2021b; Lin et al., 2022). Choi et al. (2021) observed a drop in cecal SCFA on 6 d post-challenge but an increase on 9 d post-challenge. Taken together, it can be proposed that Eimeria generally decreases the concentration of SCFA, followed by a transient but significant SCFA increase, before gradually returning to the normal level. The current study and a previous work indicated that the elevation in total SCFA content is in part due to the increased butyrate content (Hilliar et al., 2020), partly explained by the increase of butyrate producers Anaerostipes butyraticus and Bifidobacterium pseudolongum as is subsequently discussed.

Table 7.

Short chain fatty acid profile (mM) in cecal content for the broiler chickens challenged or unchallenged with mixed Eimeria spp. in response to dietary supplementations.1

Treatment Eimeria Supplementation Acetate Propionate Isobutyrate Butyrate Isovalerate Valerate Total SCFA
1 Con 64.9b 2.38 0.406 9.0b 0.538 0.820 78.1b
2 XYL 91.7a 6.01 0.149 16.4ab 0.186 1.025 115.5a
3 XYL + PRO 96.3a 2.88 0.000 16.0ab 0.000 0.433 115.7a
4 XOS 96.9a 2.72 0.057 17.2ab 0.103 0.608 117.6a
5 + Con 72.6ab 2.04 0.966 22.8a 1.291 1.273 101.0ab
6 + XYL 70.8ab 1.72 0.846 18.0ab 1.197 1.027 93.6ab
7 + XYL + PRO 75.8ab 1.88 0.845 22.3a 1.159 1.253 103.3ab
8 + XOS 71.6ab 1.90 0.928 17.6ab 1.223 1.144 94.4ab
Pooled SEM 5.91 1.453 0.1482 2.54 0.1960 0.2339 7.55
Means for main effect of Eimeria challenge
87.5 3.50 0.153 14.6 0.207 0.722 106.7
+ 72.7 1.89 0.896 20.2 1.217 1.174 98.1
Pooled SEM 3.32 0.713 0.0732 1.32 0.0973 0.1134 4.25
P-values for main effect of Eimeria challenge 0.013 0.132 <0.001 0.016 <0.001 0.019 0.309
Means for main effect of supplementations
Con 68.8 2.21 0.686 15.9 0.915 1.047 89.5
XYL 81.3 3.86 0.497 17.2 0.692 1.026 104.6
XYL + PRO 86.1 2.38 0.423 19.2 0.579 0.843 109.5
XOS 84.3 2.31 0.492 17.4 0.663 0.876 106.0
Pooled SEM 4.86 1.032 0.1451 2.02 0.1950 0.1732 5.87
P-values for main effect of supplementations 0.011 0.640 0.337 0.581 0.344 0.759 0.024
P-values for interactions 0.015 0.526 0.703 0.028 0.709 0.376 0.004

Con = no supplementation; XYL = xylanase; XYL + PRO = xylanase and protease; XOS = xylo-oligosaccharides; SCFA = short-chain fatty acids.

Means along a column with different superscripts are significantly different (P < 0.05).

1

n = 7 replicates for the simple effect; n = 28 replicates for the main effects of Eimeria challenge; n = 14 replicates for the main effects of each supplementation.

The Eimeria × additives supplementation interaction for cecal acetate (P = 0.02) and total SCFA (P < 0.01) concentration showed that the supplementation of all the additives increased the concentration of acetate (XYL, P = 0.02; XYL + PRO, P < 0.01; XOS, P < 0.01) and total SCFA (P < 0.01) in unchallenged treatments but not in challenged treatments. It has been demonstrated that the exogenous enzymes or prebiotics decreased the concentration of BCFA and increased the concentration of SCFA (Lin and Olukosi, 2021a, 2021b; Lin et al., 2022). The likely mechanism is suggested to be that by hydrolyzing carbohydrates, the enzymes are able to release more prebiotic oligosaccharides and preferentially promote the fermentation of the carbohydrates in the hindgut. The major products of carbohydrate fermentation are SCFA of which acetate is the predominant ceca SCFA (Shermer et al., 1998). However, the increase in cecal SCFA production in the current study did not translate into an improvement in growth performance. This is likely because the comparatively lower soluble fiber content in the diet limited the production of cecal SCFA, and the increased SCFA level did not reach the scale which can induce a considerable improvement in growth performance. The analyzed cecal protein concentration (Table 8) shows that XYL + PRO numerically decreased the cecal protein level in unchallenged birds. This likely resulted from reduced quantity of undigested protein, thus inhibiting cecal protein fermentation. However, XYL + PRO and XYL numerically increased the cecal protein level in challenged birds, thus, the beneficial effects of enzymes on the cecal substrate were more pronounced in unchallenged birds.

Table 8.

Cecal protein concentration (μg/mg) in 21-d-old broiler chickens at 6 d post-challenge after receiving diets supplemented with protease, protease plus xylanase, or prebiotic oligosaccharides in diets formulated to be high in fiber. Birds were challenged, or not with mixed Eimeria spp.1

Treatment Eimeria Supplementation Protein concentration
1 Con 48.3ab
2 XYL 47.6ab
3 XYL + PRO 45.0b
4 XOS 46.6ab
5 + Con 48.5ab
6 + XYL 49.7a
7 + XYL + PRO 50.3a
8 + XOS 47.6ab
Pooled SEM 0.96
Means for main effect of Eimeria challenge
46.9
+ 49.0
Pooled SEM 0.51
P-values 0.012
Means for main effect of supplementations
Con 48.4
XYL 48.6
XYL + PRO 47.7
XOS 47.1
Pooled SEM 0.77
P-values for main effect of supplementations 0.312
P-values for interactions 0.030

Con = no supplementation; XYL = xylanase; XYL + PRO = xylanase and protease; XOS = xylo-oligosaccharides.

Means along a column with different superscripts are significantly different (P < 0.05).

1

n = 7 replicates for the simple effect; n = 28 replicates for the main effects of Eimeria challenge; n = 14 replicates for the main effects of each supplementation.

3.5. Cecal microbial profile

Microbial richness and alpha diversity for the birds in different treatments are shown in Table 9. Supplementation of the additives had neither effects on microbial profile richness nor diversities. The number of observed features was significantly lower (P < 0.01) in challenged birds, indicating a lower richness of the microbiome. Both Shannon diversity index (P = 0.02) and Faith's phylogenetic diversity index (P < 0.01) were decreased with the challenge, demonstrating the effect of coccidiosis on decreasing intestinal microbial diversity. In addition, there were 64.6% unique species in unchallenged chickens but only 3.4% unique species in challenged chickens, indicating the loss of unique bacterial units after infection (Fig. 4).

Table 9.

Effect of Eimeria infection on richness and alpha diversity in cecal samples collected on 6 d post-challenge of 21-d-old broiler chickens after receiving diets supplemented with protease, protease plus xylanase, or prebiotic oligosaccharides in diets formulated to be high in fiber, and birds were challenged or not with mixed Eimeria spp.

Treatment Eimeria Supplementation Observed features Faith's phylogenetic diversity Shannon index
1 Con 262 18.04 5.85
2 XYL 257 17.17 5.77
3 XYL + PRO 244 17.37 6.15
4 XOS 218 15.57 5.79
5 + Con 128 8.00 5.31
6 + XYL 132 8.12 5.34
7 + XYL + PRO 165 10.26 5.82
8 + XOS 146 8.60 5.75
Pooled SEM 24.0 1.530 0.196
P-values for treatments <0.001 <0.001 0.085
Means for main effect of Eimeria challenge
245 17.04 5.89
+ 143 8.74 5.55
Pooled SEM 11.8 0.742 0.102
P-values for main effect of Eimeria challenge <0.001 <0.001 0.023
Con 195 13.02 5.58
PRO 195 12.64 5.55
PRO + XYL 205 13.82 5.98
XOS 182 12.08 5.77
Pooled SEM 22.8 1.634 0.144
P-values for main effect of supplementations 0.919 0.897 0.141

Fig. 4.

Fig. 4

(A) Venn diagram of bacterial species for challenge. Challenged with or without Eimeria spp. n = 24. (B) Venn diagram of bacterial species for feed additives. Con = no supplementation; XYL = supplemented with xylanase; XYL + PRO = supplemented with xylanase and protease; XOS = supplemented with xylo-oligosaccharides. n = 12.

None of the supplemented additives showed any effects on microbial composition at the phylum level. The lack of response on microbial composition may be partly due to the low soluble fiber in the experimental diet. On the other hand, the microbial composition was significantly influenced by Eimeria infection (Fig. 5). Eimeria infection significantly (P < 0.01) decreased the abundance of Proteobacteria and Bacteroidota. On the other hand, the composition of Actinobacteriota was significantly (P < 0.01) higher in the challenged treatments. Bacterial species with significantly different abundances due to the challenge are shown in Table 10. Eimeria challenge decreased the abundance of the Acaryochloris marina (P < 0.01), Akkermansia muciniphila (P = 0.04), Bacteroides barnesiae (P = 0.02), Bacteroides caecicola (P = 0.04), Campylobacter concisus (P = 0.02), Clostridium tyrobutyricum (P = 0.04), Desulfovibrio piger (P < 0.01), Haemophilus haemolyticus (P = 0.02), Haemophilus influenzae (P < 0.01), Haemophilus parahaemolyticus (P = 0.04), Lactobacillus brevis (P < 0.01), Plumaria plumosa (P = 0.02), and Prevotella melaninogenica (P < 0.01), but increased the relative abundance of A. butyraticus (P < 0.01), Bacteroides thetaiotaomicron (P = 0.04), B. pseudolongum (P < 0.01), Blautia hydrogenotrophica (P < 0.01), Eubacteriaceae bacterium (P = 0.04), Lachnoclostridium phocaeense (P = 0.02), Lactobacillus johnsonii (P < 0.01) and Lactobacillus pontis (P < 0.01). Particularly, the abundance of A. butyraticus was increased 4.2-fold, B. pseudolongum was increased 8-fold, and L. pontis was increased 6.7-fold.

Fig. 5.

Fig. 5

Bar chart showing relative abundance of bacterial phyla in each treatment (6 d post-challenge). n = 6. Con/− = unchallenged and no supplementation treatment; XYL/− = unchallenged and supplemented with xylanase treatment; XYL + PRO/− = unchallenged and supplemented with xylanase and protease treatment; XOS/− = unchallenged and supplemented with xylo-oligosaccharides treatment; Con/+ = challenged-no supplementation treatment; XYL/+ = challenged and supplemented with xylanase treatment; XYL + PRO/+ = challenged and supplemented with xylanase and protease treatment; XOS/+ = challenged and supplemented with xylo-oligosaccharides treatment. Only phyla with relative abundances ≥1% in at least one sample type are shown. ∗Indicates a P-value ≤0.05 for the contrast: unchallenged versus challenge.

Table 10.

Bacterial species with significantly different abundances (%) in cecal samples collected on 6 d post-challenge from21-d-old broiler chickens challenged, or not with mixed Eimeria spp.

Bacterial species Unchallenged Challenged P-value
Acaryochloris marina 0.020 0.000 <0.001
Akkermansia muciniphila 0.092 0.047 0.040
Anaerostipes butyraticus 1.049 4.404 <0.001
Bacteroides barnesiae 0.088 0.007 0.018
Bacteroides caecicola 0.056 0.003 0.040
Bacteroides thetaiotaomicron 0.000 0.007 0.039
Bifidobacterium pseudolongum 0.648 5.173 <0.001
Blautia hydrogenotrophica 0.691 1.265 0.001
Campylobacter concisus 0.005 0.000 0.020
Clostridium tyrobutyricum 0.014 0.000 0.039
Desulfovibrio piger 0.083 0.000 0.005
Eubacteriaceae bacterium 0.001 0.009 0.042
Haemophilus haemolyticus 0.024 0.000 0.020
Haemophilus influenzae 0.057 0.000 0.005
Haemophilus parahaemolyticus 0.014 0.000 0.039
Lachnoclostridium phocaeense 0.267 0.430 0.019
Lactobacillus brevis 0.046 0.000 0.002
Lactobacillus johnsonii 0.431 1.558 <0.001
Lactobacillus pontis 0.099 0.662 <0.001
Plumaria plumosa 0.008 0.006 0.020
Prevotella melaninogenica 0.072 0.061 <0.001

Anaerostipes is one of the important butyrate producers and has cross-feeding interactions with Bifidobacterium and Lactobacillus (De Maesschalck et al., 2015; Rivière et al., 2016; Biragyn and Ferrucci, 2018). Lactobacillus produces lactate, which is utilized by butyrate-producer Anaerostipes (De Maesschalck et al., 2015). In addition, acetate produced by Bifidobacterium can also be utilized by Anaerostipes (Rivière et al., 2016). It can be conjectured that the increased Bifidobacterium and Lactobacillus stimulated the growth of Anaerostipes by cross-feeding interactions, thus increasing the production of butyrate in the current study. This can be considered a possible protective action of the intestine trying to compensate for Eimeria-induced dysbiosis.

4. Conclusion

In conclusion, Eimeria infection significantly depressed chickens' growth performance and nutrient utilization. In addition, the infection detrimentally affected gut health with nutrients transporters downregulation, immunogenic stimulation and microbiota perturbation. All the supplemented additives improved the concentration of acetate and total SCFA in unchallenged birds, suggesting that improved SCFA is one of the potential mechanisms by which the additives supported chickens’ gut health. However, the supplemented additives had no impact on the cecal microbiota.

Author contributions

Oluyinka A. Olukosi: Conceptualization, Methodology, Validation, Investigation, Data curation, Resources, Writing - Reviewing and Editing, Supervision, Project administration, Funding acquisition. Yang Lin: Conceptualization, Methodology, Investigation, Formal analysis, Software, Visualization, Writing - Original draft preparation. Jeferson M. Lourenco: Software, Visualization, Formal analysis, Resources, Writing - Reviewing and Editing.

Declaration of competing interest

We declare that we have no financial and personal relationships with other people or organizations that can inappropriately influence our work, and there is no professional or other personal interest of any nature or kind in any product, service and/or company that could be construed as influencing the content of this paper.

Acknowledgments

The authors acknowledge the assistance of Lindsey Rackett, Derell Hardman, Mohammad Pilevar, Shravani Veluri, and Adeleye Ajao for the care of animals and chemical analysis. The authors acknowledge the assistance of Po-yun Teng for technical consulting. The authors acknowledge the assistance of Parastoo Azadi, Ian M Black, and Grace Lu in providing equipment and technical support for oligosaccharides analysis. This work is supported by the United States Department of Agriculture (USDA) National Institute of Food and Agriculture, Hatch project 1021533. The work was also supported in part by a cooperative agreement 58-6040-8-034 from the USDA – Agricultural Research Service and by the U. S. Department of Energy, Office of Science, Basic Energy Sciences, under Award DE-SC0015662 to Parastoo Azadi at the Complex Carbohydrate Research Center, USA.

Footnotes

Peer review under responsibility of Chinese Association of Animal Science and Veterinary Medicine.

References

  1. Akerele G., Al Hakeem W.G., Lourenco J., Selvaraj R. The effect of necrotic enteritis challenge on production performance, cecal microbiome, and cecal tonsil transcriptome in broilers. Pathogens. 2022;11(8):839. doi: 10.3390/pathogens11080839. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Allen P.C., Fetterer R.H. Recent advances in biology and immunobiology of Eimeria species and in diagnosis and control of infection with these coccidian parasites of poultry. Clin Microbiol Rev. 2002;15:58–65. doi: 10.1128/CMR.15.1.58-65.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Amerah A.M., Ravindran V. Effect of coccidia challenge and natural betaine supplementation on performance, nutrient utilization, and intestinal lesion scores of broiler chickens fed suboptimal level of dietary methionine. Poult Sci. 2014;94:673–680. doi: 10.3382/ps/pev022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Annison G. Anti-nutritive effect of wheat pentosans in broiler chickens: roles of viscosity and gut microflora. Br Poult Sci. 1992;33:821–834. doi: 10.1080/00071669208417524. [DOI] [PubMed] [Google Scholar]
  5. AOAC . Official methods of analysis. 18th ed. AOAC International; Gaithersburg, MD: 2006. [Google Scholar]
  6. Bedford M.R., Partridge G.G. 2022. Enzymes in farm animal nutrition. [Google Scholar]
  7. Biragyn A., Ferrucci L. Gut dysbiosis: a potential link between increased cancer risk in ageing and inflammaging. Lancet Oncol. 2018;19:e295–e304. doi: 10.1016/S1470-2045(18)30095-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Blake D.P., Knox J., Dehaeck B., Huntington B., Rathinam T., Ravipati V., Ayoade S., Gilbert W., Adebambo A.O., Jatau I.D., Raman M., Parker D., Rushton J., Tomley F.M. Re-calculating the cost of coccidiosis in chickens. Vet Res. 2020;51:1–14. doi: 10.1186/s13567-020-00837-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Bozkurt M., Aysul N., Küçükyilmaz K., Aypak S., Ege G., Çatli A.U., Akşit H., Çöven F., Seyrek K., Çinar M. Efficacy of in-feed preparations of an anticoccidial, multienzyme, prebiotic, probiotic, and herbal essential oil mixture in healthy and Eimeria spp.-infected broilers. Poult Sci. 2014;93:389–399. doi: 10.3382/ps.2013-03368. [DOI] [PubMed] [Google Scholar]
  10. Cervantes H.M. Antibiotic-free poultry production: is it sustainable? J Appl Poult Res. 2015;24:91–97. [Google Scholar]
  11. Chapman H.D., Jeffers T.K., Williams R.B. Forty years of monensin for the control of coccidiosis in poultry. Poult Sci. 2010;89:1788–1801. doi: 10.3382/ps.2010-00931. [DOI] [PubMed] [Google Scholar]
  12. Choi J., Ko H., Tompkins Y.H., Teng P.Y., Lourenco J.M., Callaway T.R., Kim W.K. Effects of Eimeria tenella infection on key parameters for feed efficiency in broiler chickens. Animals. 2021;11:3428. doi: 10.3390/ani11123428. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Craig A.D., Khattak F., Hastie P., Bedford M.R., Olukosi O.A. The similarity of the effect of carbohydrase or prebiotic supplementation in broilers aged 21 days, fed mixed cereal diets and challenged with coccidiosis infection. PLoS One. 2020;15(2) doi: 10.1371/journal.pone.0229281. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Craig A.D., Khattak F., Hastie P., Bedford M.R., Olukosi O.A. Xylanase and xylo- oligosaccharide prebiotic improve the growth performance and concentration of potentially prebiotic oligosaccharides in the ileum of broiler chickens. Br Poult Sci. 2020;61:70–78. doi: 10.1080/00071668.2019.1673318. [DOI] [PubMed] [Google Scholar]
  15. Dalloul R.A., Lillehoj H.S. Poultry coccidiosis: recent advancements in control measures and vaccine development. Expert Rev Vaccines. 2006;5:143–163. doi: 10.1586/14760584.5.1.143. [DOI] [PubMed] [Google Scholar]
  16. De Maesschalck C., Eeckhaut V., Maertens L., De Lange L., Marchal L., Nezer C., De Baere S., Croubels S., Daube G., Dewulf J., Haesebrouck F., Ducatelle R., Taminau B., Van Immerseel F. Effects of Xylo-oligosaccharides on broiler chicken performance and microbiota. Appl Environ Microbiol. 2015;81:5880–5888. doi: 10.1128/AEM.01616-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Gremlich S., Bonny C., Waeber G., Thorens B. Fatty acids decrease IDX-1 expression in rat pancreatic islets and reduce GLUT2, glucokinase, insulin, and somatostatin levels. J Biol Chem. 1997;272:30261–30269. doi: 10.1074/jbc.272.48.30261. [DOI] [PubMed] [Google Scholar]
  18. Guo S., Liu D., Zhao X., Li C., Guo Y. Xylanase supplementation of a wheat-based diet improved nutrient digestion and mRNA expression of intestinal nutrient transporters in broiler chickens infected with Clostridium perfringens. Poult Sci. 2014;93:94–103. doi: 10.3382/ps.2013-03188. [DOI] [PubMed] [Google Scholar]
  19. Hilhorst R., Gruppen H., Orsel R., Laane C., Schols H.A., Voragen A.G.J. Effects of xylanase and peroxidase on soluble and insoluble arabinoxylans in wheat bread dough. J Food Sci. 2002;67:497–506. [Google Scholar]
  20. Hilliar M., Keerqin C., Girish C.K., Barekatain R., Wu S.B., Swick R.A. Reducing protein and supplementing crystalline amino acids, to alter dietary amino acid profiles in birds challenged for subclinical necrotic enteritis. Poult Sci. 2020;99:2048–2060. doi: 10.1016/j.psj.2019.11.042. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Hong Y.H., Lillehoj H.S., Lillehoj E.P., Lee S.H. Changes in immune-related gene expression and intestinal lymphocyte subpopulations following Eimeria maxima infection of chickens. Vet Immunol Immunopathol. 2006;114:259–272. doi: 10.1016/j.vetimm.2006.08.006. [DOI] [PubMed] [Google Scholar]
  22. Johnson J., Reid W.M. Anticoccidial drugs: lesion scoring techniques in battery and floor-pen experiments with chickens. Exp Parasitol. 1970;28:30–36. doi: 10.1016/0014-4894(70)90063-9. [DOI] [PubMed] [Google Scholar]
  23. Józefiak D., Rutkowski A., Martin S.A. Carbohydrate fermentation in the avian ceca: a review. Anim Feed Sci Technol. 2004;113:1–15. (verified 24 May 2023) [Google Scholar]
  24. Józefiak D., Rutkowski A., Jensen B.B., Engberg R.M. The effect of β-glucanase supplementation of barley- and oat-based diets on growth performance and fermentation in broiler chicken gastrointestinal tract. Br Poult Sci. 2007;47:57–64. doi: 10.1080/00071660500475145. [DOI] [PubMed] [Google Scholar]
  25. Kalmendal R., Tauson R. Effects of a xylanase and protease, individually or in combination, and an ionophore coccidiostat on performance, nutrient utilization, and intestinal morphology in broiler chickens fed a wheat-soybean meal-based diet. Poult Sci. 2012;91:1387–1393. doi: 10.3382/ps.2011-02064. [DOI] [PubMed] [Google Scholar]
  26. Kiarie E., Romero L.F., Nyachoti C.M. The role of added feed enzymes in promoting gut health in swine and poultry. Nutr Res Rev. 2013;26:71–88. doi: 10.1017/S0954422413000048. [DOI] [PubMed] [Google Scholar]
  27. Lee S.A., Apajalahti J., Vienola K., González-Ortiz G., Fontes C.M.G.A., Bedford M.R. Age and dietary xylanase supplementation affects ileal sugar residues and short chain fatty acid concentration in the ileum and caecum of broiler chickens. Anim Feed Sci Technol. 2017;234:29–42. [Google Scholar]
  28. Lillehoj H.S. Effects of immunosuppression on avian coccidiosis: cyclosporin A but not hormonal bursectomy abrogates host protective immunity. Infect Immun. 1987;55:1616–1621. doi: 10.1128/iai.55.7.1616-1621.1987. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Lin Y., Olukosi O.A. Qualitative and quantitative profiles of jejunal oligosaccharides and cecal short-chain fatty acids in broiler chickens receiving different dietary levels of fiber, protein and exogenous enzymes. J Sci Food Agric. 2021;101:5190–5201. doi: 10.1002/jsfa.11165. [DOI] [PubMed] [Google Scholar]
  30. Lin Y., Olukosi O.A. Exogenous enzymes influenced eimeria-induced changes in cecal fermentation profile and gene expression of nutrient transporters in broiler chickens. Animals. 2021;11:2698. doi: 10.3390/ani11092698. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Lin Y., Teng P.-Y., Olukosi O.A. The effects of xylo-oligosaccharides on regulating growth performance, nutrient utilization, gene expression of tight junctions, nutrient transporters, and cecal short chain fatty acids profile in Eimeria-challenged broiler chickens. Poult Sci. 2022;101 doi: 10.1016/j.psj.2022.102125. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Lin Y., Lourenco J.M., Olukosi O.A. The effects of protease, xylanase, and xylo-oligosaccharides on growth performance, nutrient utilization, short-chain fatty acids, and microbiota in Eimeria-challenged broiler chickens fed low protein diet. Poult Sci. 2023;2023 doi: 10.1016/j.psj.2023.102789. (verified 24 May 2023) [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Livak K.J., Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  34. Lourenco J.M., Kieran T.J., Seidel D.S., Glenn T.C., Da Silveira M.F., Callaway T.R., Stewart R.L. Comparison of the ruminal and fecal microbiotas in beef calves supplemented or not with concentrate. PLoS One. 2020;15(4) doi: 10.1371/journal.pone.0231533. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Macdonald S.E., Nolan M.J., Harman K., Boulton K., Hume D.A., Tomley F.M., Stabler R.A., Blake D.P. Effects of Eimeria tenella infection on chicken caecal microbiome diversity, exploring variation associated with severity of pathology. PLoS One. 2017;12 doi: 10.1371/journal.pone.0184890. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Madlala T., Okpeku M., Adeleke M.A. Understanding the interactions between Eimeria infection and gut microbiota, towards the control of chicken coccidiosis: a review. Parasite. 2021;28:48. doi: 10.1051/parasite/2021047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Min W., Kim W.H., Lillehoj E.P., Lillehoj H.S. Recent progress in host immunity to avian coccidiosis: IL-17 family cytokines as sentinels of the intestinal mucosa. Dev Comp Immunol. 2013;41:418–428. doi: 10.1016/j.dci.2013.04.003. [DOI] [PubMed] [Google Scholar]
  38. Morgan N.K., Wallace A., Bedford M.R., Hawking K.L., Rodrigues I., Hilliar M., Choct M. In vitro versus in situ evaluation of xylan hydrolysis into xylo-oligosaccharides in broiler chicken gastrointestinal tract. Carbohydr Polym. 2020;230 doi: 10.1016/j.carbpol.2019.115645. [DOI] [PubMed] [Google Scholar]
  39. Munyaka P.M., Nandha N.K., Kiarie E., Nyachoti C.M., Khafipour E. Impact of combined β-glucanase and xylanase enzymes on growth performance, nutrients utilization and gut microbiota in broiler chickens fed corn or wheat-based diets. Poult Sci. 2016;95:528–540. doi: 10.3382/ps/pev333. [DOI] [PubMed] [Google Scholar]
  40. Pappu R., Rutz S., Ouyang W. Regulation of epithelial immunity by IL-17 family cytokines. Trends Immunol. 2012;33:343–349. doi: 10.1016/j.it.2012.02.008. [DOI] [PubMed] [Google Scholar]
  41. Paris N.E., Wong E.A. Expression of digestive enzymes and nutrient transporters in the intestine of Eimeria maxima-infected chickens. Poult Sci. 2013;92:1331–1335. doi: 10.3382/ps.2012-02966. [DOI] [PubMed] [Google Scholar]
  42. Peek H.W., van der Klis J.D., Vermeulen B., Landman W.J.M. Dietary protease can alleviate negative effects of a coccidiosis infection on production performance in broiler chickens. Anim Feed Sci Technol. 2009;150:151–159. [Google Scholar]
  43. Pourabedin M., Zhao X. Prebiotics and gut microbiota in chickens. FEMS Microbiol Lett. 2015;362:122. doi: 10.1093/femsle/fnv122. [DOI] [PubMed] [Google Scholar]
  44. Rivière A., Selak M., Lantin D., Leroy F., De Vuyst L. Bifidobacteria and butyrate-producing colon bacteria: importance and strategies for their stimulation in the human gut. Front Microbiol. 2016;7 doi: 10.3389/fmicb.2016.00979. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Rose M.E., Long P.L. Resistance to Eimeria infections in the chicken: the effects of thymectomy, bursectomy, whole body irradiation and cortisone treatment. Parasitology. 1970;60(2):291–299. doi: 10.1017/s0031182000078124. [DOI] [PubMed] [Google Scholar]
  46. Scholz-Ahrens K.E., Schaafsma G., Van den Heuvel E.G.H.M., Schrezenmeir J. vol. 73. Oxford Academic; 2001. Effects of prebiotics on mineral metabolism; pp. 459s–464s. (Proceedings of the American Journal of Clinical Nutrition). [DOI] [PubMed] [Google Scholar]
  47. Shermer C.L., Maciorowski K.G., Bailey C.A., Byers2 F.M., Ricke1 S.C. Caecal metabolites and microbial populations in chickens consuming diets containing a mined humate compound. J Sci Food Agric. 1998;77:479–486. (verified 25 May 2023) [Google Scholar]
  48. Short F.J., Gorton P., Wiseman J. Determination of titanium dioxide added as an inert marker in chicken digestibility studies. Anim Feed Sci Technol. 1996;59:215–221. [Google Scholar]
  49. Silva E.K., Arruda H.S., Pastore G.M., Meirels M.A.A. Xylooligosaccharides chemical stability after high-intensity ultrasound processing of prebiotic orange juice. Ultrason Sonochem. 2020;63:104942. doi: 10.1016/j.ultsonch.2019.104942. [DOI] [PubMed] [Google Scholar]
  50. Singh A.K., Berrocoso J.F.D., Dersjant-Li Y., Awati A., Jha R. Effect of a combination of xylanase, amylase and protease on growth performance of broilers fed low and high fiber diets. Anim Feed Sci Technol. 2017;232:16–20. [Google Scholar]
  51. Su S., Miska K.B., Fetterer R.H., Jenkins M.C., Wong E.A. Expression of digestive enzymes and nutrient transporters in Eimeria acervulina-challenged layers and broilers. Poult Sci. 2014;93:1217–1226. doi: 10.3382/ps.2013-03807. [DOI] [PubMed] [Google Scholar]
  52. Su S., Miska K.B., Fetterer R.H., Jenkins M.C., Wong E.A. Expression of digestive enzymes and nutrient transporters in Eimeria-challenged broilers. Exp Parasitol. 2015;150:13–21. doi: 10.1016/j.exppara.2015.01.003. [DOI] [PubMed] [Google Scholar]
  53. Teng P.Y., Yadav S., Castro F.L. de S., Tompkins Y.H., Fuller A.L., Kim W.K. Graded Eimeria challenge linearly regulated growth performance, dynamic change of gastrointestinal permeability, apparent ileal digestibility, intestinal morphology, and tight junctions of broiler chickens. Poult Sci. 2020;99:4203–4216. doi: 10.1016/j.psj.2020.04.031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Weaver C.M. Diet, gut microbiome, and bone health. Curr Osteoporos Rep. 2015;13:125–130. doi: 10.1007/s11914-015-0257-0. (verified 22 May 2023) [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Wedekind K.J., Chen J., Yan F., Escobar J., Vazquez-Anon M. Efficacy of a mono-component protease is affected by trypsin inhibitor concentration in soybean meal. Anim Feed Sci Technol. 2020;265 [Google Scholar]
  56. Yang J., Summanen P.H., Henning S.M., Hsu M., Lam H., Huang J., et al. Xylooligosaccharide supplementation alters gut bacteria in both healthy and prediabetic adults: a pilot study. Front Physiol. 2015;6:216. doi: 10.3389/fphys.2015.00216. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Animal Nutrition are provided here courtesy of KeAi Publishing

RESOURCES