TABLE 1.
Amino acid substitutions and their consequences on the solubility and fluorescence properties of E. coli UMP kinase
| Amino acid substituted | Codon alteration | Sequence of mutagenic oligonucleotide | % of activity in the pelleta | Relative fluorescence intensityb
|
|
|---|---|---|---|---|---|
| −UTP | +UTP | ||||
| R62H | CGT→CAT | 5′CCAGCGCCATGGAACAGGTTA3′ | 83 | 89 | 203 |
| D77N | GAC→AAC | 5′CCCCATGTGGTTGCCCACAACG3′ | 84 | 112 | 108 |
| D146N | GAC→AAC | 5′GGAAGCTGCTGAGTTGGTGGT3′ | 84 | 178 | 220 |
| D159N | GAT→AAT | 5′CAGCACCACATTGGCTTCAATTTC3′ | 10 | 102 | 208 |
| D168N | GAC→AAC | 5′TAAACACGCCGTTAACTTTGGT3′ | 97 | 64 | 180 |
| D174N | GAT→AAT | 5′TCTTTCGCCGGATTAGCGGTA3′ | 98 | 67 | 164 |
| D201N | GAC→AAC | 5′GGCCGCCAGGTTCATGGACTTT3′ | 42 | 138 | 215 |
Sonicated bacterial extract in 50 mM Tris-HCl (pH 7.4) was centrifuged at 14,000 rpm for 4 min, and then the supernatant was separated from the pellet, which was resuspended at the original volume with 50 mM Tris-HCl (pH 7.4) or with 100 mM borate (pH 9). The activity of each fraction was determined at pH 7.4 with 1 mM ATP and 1 mM UMP as substrates.
The emission spectrum of purified UMP kinase (1 or 2 μM in terms of monomer) in 50 mM Tris-HCl (pH 7.4) was recorded between 305 and 400 nm. The fluorescence maxima were 332 nm for the wild-type enzyme and D146N mutant, 333 nm for the R62H and D159N mutants, 334 nm for the D168N and D174N mutants, and 335 nm for the D201N mutant. UTP when present did not shift the fluorescence maximum of UMP kinase. It was used at 10 μM for the wild type and D146N, D159N, D168N, D174N and D201N mutants and 300 μM for the R62H mutant. For the D77N mutant, up to 1 mM UTP no increase in fluorescence intensity was observed. The fluorescence intensity of the wild-type UMP kinase in the absence of UTP was considered 100%.