KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Alexa Fluor® 488 anti-mouse CD4 | Biolegend | 100423 |
| Alexa Fluor® 488 anti-mouse CD45 | Biolegend | 103122 |
| Alexa Fluor® 488 anti-mouse CD8a | Biolegend | 100723 |
| APC anti-mouse CD4 | Biolegend | 100516 |
| APC anti-mouse IL-2 | Biolegend | 503810 |
| APC Rat IgG2b, κ Isotype Ctrl | Biolegend | 400612 |
| APC/Cy7 anti-mouse CD45 | Biolegend | 103116 |
| APC/Cy7 anti-mouse CD8a | Biolegend | 100714 |
| Brilliant Violet 421™ anti-mouse CD19 | Biolegend | 115538 |
| Brilliant Violet 421™ anti-mouse Ki-67 | Biolegend | 652411 |
| PE/Cy7 anti-mouse CD326 (Ep-CAM) | Biolegend | 118216 |
| PE/Cy7 anti-mouse CD3ε | Biolegend | 100320 |
| PerCP/Cy5.5 anti-mouse CD335 (NKp46) | Biolegend | 137610 |
| Alexa Fluor® 488 Mouse IgG2a, κ Isotype Ctrl Antibody | Biolegend | 400233 |
| PE Rat IgG2b, κ Isotype Ctrl Antibody | Biolegend | 400636 |
| APC Mouse IgG2a, κ Isotype Ctrl Antibody | Biolegend | 400220 |
| APC anti-human HLA-A, B, C Antibody | Biolegend | 311410 |
| APC anti-mouse CD335 (NKp46) Antibody | Biolegend | 137607 |
| PE anti-mouse H-2K b/H-2D b Antibody | Biolegend | 114607 |
| PE Mouse IgG2a, κ Isotype Ctrl Antibody | Biolegend | 400212 |
| Brilliant Violet 421™ Mouse IgG2b, κ Isotype Ctrl Antibody | Biolegend | 400341 |
| PE anti-mouse RAE-1δ Antibody | Biolegend | 133203 |
| PE Mouse IgG1, κ Isotype Ctrl Antibody | Biolegend | 400111 |
| APC Mouse IgG2b, κ Isotype Ctrl Antibody | Biolegend | 400319 |
| APC Rat IgG2a, κ Isotype Ctrl Antibody | Biolegend | 400511 |
| APC Mouse IgG1, κ Isotype Ctrl Antibody | Biolegend | 400119 |
| PerCP/Cy5.5 anti-mouse CD8a Antibody | Biolegend | 100733 |
| APC anti-mouse IgG2a Antibody | Biolegend | 407110 |
| APC Rat IgG1, κ Isotype Ctrl Antibody | Biolegend | 400411 |
| Brilliant Violet 421™ Mouse IgG1, κ Isotype Ctrl Antibody | Biolegend | 400157 |
| PE/Cy7 Mouse IgG1, κ Isotype Ctrl Antibody | Biolegend | 400125 |
| PerCP/Cy5.5 anti-mouse CD3ε Antibody | Biolegend | 100328 |
| Alexa Fluor® 488 anti-mouse CD3ε Antibody | Biolegend | 100321 |
| PE anti-mouse CD4 Antibody | Biolegend | 100512 |
| APC anti-mouse CD107a (LAMP-1) Antibody | Biolegend | 121614 |
| PerCP/Cy5.5 anti-mouse CD107a (LAMP-1) Antibody | Biolegend | 121626 |
| Brilliant Violet 421™ Rat IgG2a, κ Isotype Ctrl Antibody | Biolegend | 400549 |
| PE anti-mouse IL-2 Antibody | Biolegend | 503808 |
| TruStain fcX™ (anti-mouse CD16/32) Antibody | Biolegend | 101320 |
| Brilliant Violet 421™ anti-mouse CD3ε Antibody | Biolegend | 100341 |
| PE Rat IgG1, κ Isotype Ctrl Antibody | Biolegend | 400408 |
| PE/Cy7 Mouse IgG2b, κ Isotype Ctrl Antibody | Biolegend | 400326 |
| PE/Cy7 anti-mouse CD3ε Antibody | Biolegend | 100320 |
| PE Rat IgG2a, κ Isotype Ctrl Antibody | Biolegend | 400508 |
| PE anti-human HLA-A,B,C Antibody | Biolegend | 311406 |
| PE Mouse IgG2a, κ Isotype Ctrl (FC) Antibody | Biolegend | 400214 |
| PE anti-mouse H-2Kb/H-2Db Antibody | Biolegend | 114608 |
| Brilliant Violet 421™ anti-mouse IL-2 Antibody | Biolegend | 503826 |
| FITC anti-human/mouse Granzyme B Recombinant Antibody | Biolegend | 372206 |
| PerCP/Cyanine5.5 anti-mouse CD8a Antibody | Biolegend | 100734 |
| FITC Mouse IgG1, κ Isotype Ctrl (ICFC) Antibody | Biolegend | 400138 |
| PE anti-mouse NK-1.1 Antibody | Biolegend | 108708 |
| Alexa Fluor® 488 anti-mouse CD49b (pan-NK cells) Antibody | Biolegend | 108913 |
| APC anti-mouse CD49b (pan-NK cells) Antibody | Biolegend | 108910 |
| PE/Cy7 Rat IgG2a, κ Isotype Ctrl Antibody | Biolegend | 400522 |
| PE/Cy7 Rat IgG2b, κ Isotype Ctrl Antibody | Biolegend | 400617 |
| PE anti-mouse IFN-γ Antibody | Biolegend | 505808 |
| APC/Cyanine7 anti-mouse CD45 Antibody | Biolegend | 103116 |
| InVivoMAb rat IgG2b isotype control | BioXcell | BE0090 |
| InVivoMAb anti-mouse CD8α | BioXcell | BE0117 |
| InVivoPlus anti-mouse CTLA-4 (CD152) | BioXcell | BP0164 |
| p53 (1C12) Mouse mAb | Cell signaling Technology | 2524 |
| Phospho-Histone H2A.X (Ser139) (20E3) Rabbit mAb | Cell signaling Technology | 9718 |
| Ki-67 Recombinant Rabbit Monoclonal Antibody (SP6) | Thermofisher | MA5–14520 |
| CD8α (C8/144B) Mouse mAb | Cell signaling Technology | 70306 |
| STING (D2P2F) Rabbit mAb | Cell signaling Technology | 13647 |
| Phospho-STING (Ser365) (D8F4W) Rabbit mAb | Cell signaling Technology | 72971 |
| Vinculin (E1E9V) XP® Rabbit mAb | Cell signaling Technology | 13901 |
| GAPDH (D16H11) XP® Rabbit mAb | Cell signaling Technology | 5174 |
| Phospho-TBK1/NAK (Ser172) (D52C2) XP® Rabbit mAb | Cell signaling Technology | 5483 |
| Caspase-3 Antibody | Cell signaling Technology | 9662 |
| DAPI | Cell signaling Technology | 4083 |
| Bacterial and virus strains | ||
| NEB Stable Competent E. coli | NEB | C3040H |
| Biological samples | ||
| Chemicals, peptides, and recombinant proteins | ||
| Nutlin-3a | MedChemExpress | HY-10029 |
| Recombinant Murine IL-2 | PeproTech | 212–12 |
| OVA Peptide (323–339) | Genscript | RP10610 |
| Collagenase, Type IV, powder | Themofisher | 17104019 |
| DNase I recombinant, RNase-free | Millipore | 4716728001 |
| Cell Activation Cocktail (with Brefeldin A) | Biolegend | 423304 |
| Critical commercial assays | ||
| CyQUANT™ LDH Cytotoxicity Assay | Invtrogen | C20300 |
| MojoSort™ Mouse CD8 T Cell Isolation Kit | Biolegend | 480007 |
| DNeasy Blood & Tissue Kits | Qiagen | 69504 |
| QIAprep Spin Miniprep Kit | Qiagen | 27104 |
| RNeasy Mini Kit | Qiagen | 74104 |
| PowerUp™ SYBR™ Green Master Mix | Thermofisher | A25742 |
| Deposited data | ||
| Tumor mutational burden in genetically engineered-mouse model | SRA | PRJNA933600 |
| Experimental models: Cell lines | ||
| A549 | UTSW | Hamon Center for Therapeutic Oncology Research |
| H23 | UTSW | Hamon Center for Therapeutic Oncology Research |
| MC38 | Kerafast | ENH204-FP |
| KP9–1 | Akbay et al, 2017, JTO25 | |
| KP9–3 | Akbay et al, 2017, JTO25 | |
| KP67–1 | Generated in this study | |
| KPO24 | Generated in this study | |
| KPO24–1 | Generated in this study | |
| KPO24–2 | Generated in this study | |
| KPO24–3 | Generated in this study | |
| KPO24–4 | Generated in this study | |
| KPO105 | Generated in this study | |
| KPO24-TetOp-p53 | Generated in this study | |
| KPO105-TetOp-p53 | Generated in this study | |
| Experimental models: Organisms/strains | ||
| C57BL/6J | Jackson Laboratory | 000664 |
| B6.129S6-Poletm1Dcas/J | Jackson Laboratory | 037051 |
| B6(Cg)-Krastm5Tyj/J | Jackson Laboratory | 023590 |
| B6.129S2-Trp53tm1Tyj/J | Jackson Laboratory | 002101 |
| C57BL/6-Tg(TcraTcrb)1100Mjb/J | Jackson Laboratory | 003831 |
| Oligonucleotides | ||
| mouse Actb Forward primer: GCCCTGAGGCTCTTTTCCAG | sigma | |
| mouse Actb Reverse primer: TGCCACAGGATTCCATACCC |
sigma | |
| mouse Tap1 Forward primer: GCTGTTCAGGTCCTGCTCTC | sigma | |
| mouse Tap1 reverse primer: CACTGAGTGGAGAGCAAGGAG | sigma | |
| mouse Erap1 Forward primer: CGAGGACCTGTGGAATAGCATG | sigma | |
| mouse Erap1 reverse primer: CATCTACAACCTCCTGACGCCA | sigma | |
| Mouse Ccl2 Forward primer: CATCCACGTGTTGGCTCA |
||
| Mouse Ccl2 reverse primer: GATCATCTTGCTGGTGAATGAGT |
||
| Recombinant DNA | ||
| cDNA clone for Mus musculus transformation related protein 53 (Trp53), transcript variant 2, mRNA. | Genscript | NM_001127233.1 |
| Software and algorithms | ||
| FlowJo | Tree Star Inc. | https://www.flowjo.com/solutions/flowjo |
| BD FACSAria™ III System | BD Biosciences | https://www.bdbiosciences.com/en-us/instruments/research-instruments/research-cell-sorters/facsaria-iii |
| GraphPad Prism software 9.0 | GraphPad Software, Inc. | https://graphpad.com/scientific-software/prism/ |
| Image J | NIH | imagej.nih.gov/ij/download/ |
| 3D slicer | NIH | https://www.slicer.org |
| Incucyte Base Analysis Software | Sartorius | https://www.sartorius.com/en/products/live-cell-imaging-analysis/live-cell-analysis-software/incucyte-base-software |
| NDP.view2 | Hamamatsu | https://www.hamamatsu.com/eu/en/product/life-science-and-medical-systems/digital-slide-scanner/U12388–01.html |
| Trim Galore | https://www.bioinformatics.babraham.ac.uk/projects/trim_galore/ | |
| Burrows-Wheeler Aligner (BWA, v0.7.17) | https://academic.oup.com/bioinformatics/article/25/14/1754/225615 | |
| Picard | https://broadinstitute.github.io/picard | |
| Genome Analysis Toolkit (GATK, 4.1.4.0) | https://www.nature.com/articles/ng.806 | |
| Minimap2 (v2.24-r1122) | https://academic.oup.com/bioinformatics/article/34/18/3094/4994778?login=true | |
| SAMtools (v1.9) | https://academic.oup.com/bioinformatics/article/25/16/2078/204688?login=true | |
| R | R foundation | https://www.r-project.org |