| Antibodies |
| CALB1 |
SWANT |
Cat#300 |
| CLDN11 |
Invitrogen |
Cat#36-4500 |
| DLX3 |
Santa Cruz |
Cat#sc-514094 |
| DLX5 |
Novus Biologicals |
Cat#NBP1-85793 |
| FBXO2 |
Santa Cruz |
Cat#sc-398111 |
| GATA3 |
R&D Systems |
Cat#AF2605 |
| GFP |
Thermo Fisher |
Cat#A-11120 |
| INSM1 |
Santa Cruz |
Cat#sc-271408 |
| LMOD3 |
Proteintech |
Cat#14948-1-AP |
| LMX1A |
Sigma-Aldrich |
Cat#AB10533 |
| MYO7A |
Proteus |
Cat#256790 |
| MYO7A |
Santa Cruz |
Cat#sc-74516 |
| NDGR1 |
Abcam |
Cat#ab-124689 |
| NR2F1 |
Invitrogen |
Cat#ab-124689 |
| NR2F1 |
R&D Systems |
Cat#PP-H8132-00 |
| OCT4 (conjugated to AF488) |
eBioscience |
Cat#53584182 |
| OTX2 |
R&D Systems |
Cat#AF1979 |
| PAX2 |
Abnova |
Cat#H00005076-M01 |
| PAX8 |
Abcam |
Cat#AB97477 |
| PCP4 |
Santa Cruz |
Cat#sc-74816 |
| PCP4 |
Invitrogen |
Cat#PA5-52209 |
| phalloidin (conjugated to AF488) |
Thermo Fisher |
Cat#A12379 |
| POU4F3 |
Santa Cruz |
Cat#sc-81980 |
| Prestin |
Generous gift of Drs. Jing Zheng and Kazuaki Homma et al.28
|
NW-802 |
| Sox10 |
eBioscience |
Cat#14-5923-82 |
| Sox2 |
BD Pharmingen |
Cat#561469 |
| SSEA4 (conjugated to AF594) |
BioLegend |
Cat#330414 |
| SULF1 |
Invitrogen |
Cat#PA5-113112 |
| TUBA4A |
Sigma-Aldrich |
Cat#T6793 |
| TUJ1 (TUBB3) |
Biolegend |
Cat#801201 |
| Bacterial and virus strains |
|
|
| DH5a |
New England Biolabs |
Cat#C2987H |
| Biological samples |
|
|
| GW 13 Human fetal cochlea |
This paper |
N/A |
| GW 18 Human fetal cochlea |
This paper |
N/A |
| GW 18 Human fetal vestibule |
This paper |
N/A |
| Chemicals, peptides, and recombinant proteins |
|
|
| Accutase |
Thermo Fisher Scientific |
Cat# A1110501 |
| Advanced DMEM/F12 |
Thermo Fisher Scientific |
Cat#12634028 |
| Alt-R™ S.p. Cas9 Nuclease V3 |
Integrated DNA technologies (IDT) |
Cat#1081058 |
| B27 (minus vitamin A) |
Thermo Fisher Scientific |
Cat#12587010 |
| β-Mercaptoethanol |
Thermo Fisher Scientific |
Cat#21985023 |
| BMP4 |
Reprocell |
Cat#03-0007 |
| CHIR99021 |
Reprocell |
Cat#04-0004-10 |
| DMEM/F12 +HEPES |
Thermo Fisher Scientific |
Cat#11320033 |
| DPBS |
Thermo Fisher Scientific |
Cat#14040133 |
| Essential 6 (E6) medium |
Thermo Fisher Scientific |
Cat#A1516401 |
| Essential 8 (E8) Flex medium |
Thermo Fisher Scientific |
Cat#A2858501 |
| 0.5 M EDTA, pH 8.0 |
Thermo Fisher Scientific |
Cat#15575020 |
| FGF2 |
Stem Cell Technologies |
Cat#780003 |
| GFR Matrigel |
Corning |
Cat#354230 |
| GlutaMAX |
Thermo Fisher Scientific |
Cat#35050061 |
| Glutaldehyde |
Electron Microscopy Sciences (EMS) |
Cat#16537-15 |
| IWP-2 |
Tocris |
Cat#3533 |
| LDN193189 |
Stemgent |
Cat#04-0074-02 |
| L-15 cell culture medium |
Thermo Fisher Scientific |
Cat#21083027 |
| Neurobasal medium |
Thermo Fisher Scientific |
Cat#21103049 |
| Normocin |
Invivogen |
Cat# ant-nr-1 |
| N2 |
Thermo Fisher Scientific |
Cat#17502048 |
| Osmium tetroxide |
Electron Microscopy Sciences (EMS) |
Cat#19150 |
| Propidium Iodide |
Invitrogen |
Cat#P1304MP |
| Purmorphamine |
Stemgent |
Cat#04-0009) |
| RevitaCell |
Thermo Fisher Scientific |
Cat#A2644501 |
| SB431542 |
Stemgent |
Cat#04-0010-05 |
| Scr7 |
Xcessbio |
Cat#M60082-2S |
| TRIzol |
Thermo Fisher Scientific |
Cat#15596026 |
| TrypLE |
Thermo Fisher Scientific |
Cat#A1217701 |
| Vitronectin-N |
Thermo Fisher Scientific |
Cat#A14700 |
| Y-27632 |
Stemgent |
Cat#04-0012-02 |
| Critical commercial assays |
| Chromium Next GEM Single Cell Kit v3 |
10x Genomics |
Cat#1000075 |
| Deposited data |
| Raw and analyzed data |
This paper |
GEO: GSE200629
|
| Experimental models: Cell lines |
| WA25 |
WiCell |
(NIHhESC-12-0196; RRID:CVCL_E080) |
| mND2-0 |
WiCell |
mND2-0 (MIRJT7i-mND2-0,RRID:CVCL_U173) |
| Oligonucleotides |
| PAX2 RT assay Fwd: CCTGGCAGGAATGGTGCCT |
This paper |
N/A |
| PAX2 RT assay Rev: GTCAGACGGGGACGATGTGG |
This paper |
N/A |
| Primers for PAX2 donor vector: see supplementary table 2
|
This paper |
N/A |
| Primers for POU4F3 donor vector: see supplementary table 2
|
This paper |
N/A |
| PAX2 gRNA: ATGACCGCCACTAGTTACCG |
This paper |
N/A |
| POU4F3-targeting sgRNA for CRISPR/Cas9 genome editing: ATTCGGCTGTCCACTGATTG |
This paper |
N/A |
| Recombinant DNA |
| SpCas9-HF1 vector |
Kleinstiver et al.14
|
Addgene#72247 |
| U6 expression vector |
Slaymaker et al.55
|
Addgene #71814 |
| Cre expression vector |
Matsuda et al.57
|
Addgene #13775 |
| FLPo expression vector |
Raymond et al.58
|
Addgene #13793 |
| 2A-eGFP-PGK-Puro vector |
Hockemeyer et al.54
|
Addgene #31938 |
| Software and algorithms |
|
|
| ImageJ |
Schneider et al.59
|
https://imagej.nih.gov/ij/
|
| Flow Jo |
FlowJo LLC |
https://www.flowjo.com/
|
| Prism 9 |
GraphPad Software |
https://graphpad.com
|
| Imaris 8 |
Bitplane |
https://Imaris.oxinst.com/
|
| R |
Team R C. R: A language and environment for statistical computing[J]. 2013. |
https://cran.r-project.org/bin/macosx/ (macOS)https://cran.r-project.org/bin/windows/base/ (Windows)https://cran.r-project.org/bin/linux/ (Linux) |
| R studio |
Team R S. Rstudio: integrated development for R[J]. Rstudio, Inc., Boston, MA URL http://www.Rstudio.com, 2015, 42: 14. |
https://www.rstudio.com/products/rstudio/download/
|
| R package Seurat |
|
https://github.com/satijalab/seurat
|
| DESeq2 |
Love et al.62
|
https://bioconductor.org/packages/release/bioc/html/DESeq2.html
|
| zingeR |
Love et al.62
|
https://github.com/statOmics/zingeR/blob/master/R/methods.R
|
| iDEA |
Ma et al.21
|
https://xzhoulab.github.io/iDEA/
|
| Custom code |
This paper |
https://github.com/HashinoLab/Moore_et¬_al_Cochlear_Organoids
|
| Nikon Elements microscope imaging software |
Nikon Corporation |
https://www.nikoninstruments.com/Products/Software/NIS-Elements-Advanced-Research/NIS-Elements-Viewer
|
