FIG. 1.

E2F-specific DNA-binding activity is dependent upon dDP in vitro. (A) Total extracts of SL2 cells were prepared and analyzed in EMSA with oligonucleotides containing an E2F-binding site (underlined) (ATTTAAGTTTCGCGCCCTTTCTCAAATTT) (left lane). The specificity of the retarded complex was verified by preincubating the extracts with a 100-fold molar excess of competing unlabeled oligonucleotides containing either a wild-type (WT) or a mutant (MT) E2F-binding site. End-labeled oligonucleotide alone was also migrated in the gel (right lane). The nonspecific band is designated by an asterisk. (B) Cells were treated with nonspecific dsRNA used as a control (NS) or with dE2F1 (E1), dE2F2 (E2), and dDP (dDP) dsRNAs. Note the lack of E2F-specific DNA-binding activity in SL2 cells following depletion of dDP.