Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primer sequences used to amplify SjAnnexin A13 gene
| Name | Primer sequence (5′–3′) | Underlined |
|---|---|---|
| SjAnnexin A13-F | CGCGGATCCATGGGAAGATCTAAACTTC | BamHI restriction enzyme sites |
| SjAnnexin A13-R | CCGCTCGAGTTAACTCCATTCAGCACC | XhoI restriction enzyme sites |
