TABLE 1.
P. aeruginosa strains, plasmids, and oligonucleotides used in this study
| Strain, plasmid, or oligonucleotide | Characteristic(s) or sequence | Source or reference |
|---|---|---|
| E. coli | ||
| JM109 | endA1 recA1 gyrA96 thi hsdR17 (rK− mK+) relA1 supE44 Δ(lac-proAB) [F′ traD36 proAB lacIqZΔM15] | Promega |
| XL1-Blue | recA1 endA1 gyrA96 thi hsdR17 supE44 relA1 lac[F′ proAB lacIqZΔM15 Tn10] | Stratagene |
| BMH71-18 mutS | thi supE lac-proAB mutS::Tn10 [F′ proAB lacIqZΔM15] | Promega |
| TB1 | ara Δ(lac-proAB) rspL φ80 lacZΔM15 hsdR | Bethesda Research Laboratories |
| BL21 (λDE3) | F−ompT [lon] hsdSB(rB− mB−; B strain); λDE3 lysogen with T7 RNA polymerase | Novagen |
| P. aeruginosa | ||
| FRD1 | CF isolate; Alg+ (due to mucA22 mutation) | 40 |
| FRD2 | algT18 Alg− | 13, 40 |
| FRD440 | algT::Tn501 | 18 |
| FRD444 | algB::Tn501 | 22 |
| FRD831 | ΔalgR::ΩaacC1 | This study |
| FRD833 | algR+ derivative of FRD831 | This study |
| FRD836 | algR7 (encoding AlgR.D54N) | This study |
| FRD838 | algR10 (encoding AlgR.D85N) | This study |
| FRD839 | algR11 (encoding AlgR.D54N.D85N) | This study |
| FRD840 | algBΔ::ΩaacC1 | This study |
| FRD842 | algB48 (encoding AlgB.R442E) | This study |
| FRD844 | algB45 (encoding AlgB.D59N) | This study |
| FRD846 | algB+ derivative of FRD840 | This study |
| FRD848 | algB22 (encoding H-AlgB) | This study |
| FRD850 | algB23 (encoding H-AlgBΔ1-145) | This study |
| FRD1049 | kinB::Tn501 | This study |
| Plasmids | ||
| pALTER-1 | ColE1 Tcr Amps f1ori | Promega |
| pRK2013 | ColE1-Tra(RK2)+ Kmr | 17 |
| pUC18 | ColE1 Ampr | 57 |
| pLAFR3 | IncP1 Tcr λcos oriT | 54 |
| pUC4K | ColE1 Ampr Kmr | Pharmacia |
| pKS− | ColE1 Ampr | Stratagene |
| pTrcHisA | ColE1 AmprlacIq Ptrc 6x His tag vector | Invitrogen |
| pEX100T | ColE1 AmproriT sacB | 53 |
| pEMR-ST | ColE1 Tcr Amps f1ori cos oriT sacB | 36 |
| pUCGM | ColE1 Ampr GmrΩaacC1 | 52 |
| pAB2001 | ColE1 Ampr Gmr | 4 |
| pSM14 | pJG222 + 0.8-kb HindIII fragment of cat; kinB-cat transcriptional fusion | This study |
| pSM50 | pSM14 with KpnI-AgeI fragment deleted | This study |
| pSM53 | pSM50 + 1.6-kb HindIII fragment containing oriT | This study |
| pSM95 | ColE1 Kmr pT7 His-KinB | 29 |
| pAL1 | IncP1 Tcr pCP13 + 20-kb HindIII fragment; algR+ | 65 |
| pJG1 | IncP1 Tcr pLAFR1 + 20-kb EcoRI fragment; algB+ kinB′ | 21 |
| pJG1::Tn501-49 | pJG1 with kinB::Tn501 | 22 |
| pDJW15 | pKS− + 3.9-kb HindIII-XhoI fragment; algB+ | 64 |
| pDJW17 | pALTER-1 + 4.3-kb HindIII-EcoRI fragment; algB+ | This study |
| pDJW52 | pKK223-3 + ptac-algB; Ampr | 63 |
| pDJW130 | pKS− + 0.9-kb XhoI-EcoRI fragment of pJG1; ′kinB | This study |
| pDJW148 | pALTER-1 + 3.9-kb HindIII-XhoI fragment; algB+ | This study |
| pDJW385 | pDJW106 mutagenized with algR5 and algR6 | This study |
| pDJW387 | pDJW385 ΔBglII + 1.5-kb BamHI of pUCGM; ΔalgR::ΩaacC1 | This study |
| pDJW389 | pEMR-ST + 3.7-kb SalI of pDJW387; ΔalgR::ΩaacC1 | This study |
| pDJW400 | pUC18 + 1.3-kb BamHI-EcoRI PCR fragment; algB22 | This study |
| pDJW403 | pTrcHisA + 1.3-kb BamHI-EcoRI fragment of pDJW400; algB22 | This study |
| pDJW406 | pUC18 + 800-bp BamHI-EcoRI PCR fragment; algB23 | This study |
| pDJW408 | pTrcHisA + 800-bp BamHI-EcoRI PCR fragment; algB23 | This study |
| pDJW430 | pALTER-1 + 3.0-kb SphI fragment of pDJW403; algB22 | This study |
| pDJW433 | pALTER-1 + 2.6-kb SphI of pDJW408; algB23 | This study |
| pDJW437 | pAB2001 + 3.0-kb SphI fragment of pDJW430; algB22 | This study |
| pDJW438 | pAB2001 + 2.6-kb SphI of pDJW433; algB23 | This study |
| pDJW470 | pUS68 + 3.1-kb KpnI-XhoI of pDJW437; algB22 | This study |
| pDJW471 | pUS68 + 2.7-kb KpnI-XhoI of pDJW438; algB23 | This study |
| pDJW525 | ColE1 Ampr KmroriT sacB | This study |
| pDJW527 | ColE1 Ampr GmroriT sacB | This study |
| pUS4 | pDJW148 mutagenized with oligonucleotide algB45 | This study |
| pUS5 | pDJW148 mutagenized with oligonucleotide algB48 | This study |
| pUS14 | pLAFR3 + HindIII-BamHI fragment of pUS4; algB45 | This study |
| pUS50 | pEX100T + 3.9-kb HindIII-XhoI fragment of pUS4; algB45 | This study |
| pUS51 | pEX100T + 3.9-kb HindIII-XhoI fragment of pUS5; algB48 | This study |
| pUS55 | pUC18 + 1.3-kb BamHI-EcoRI PCR fragment; algB45 | This study |
| pUS56 | pTrcHisA + 1.3-kb BamHI-EcoRI fragment of pUS55; algB45 | This study |
| pUS61 | pDJW17 mutagenized with oligonucleotides algB50 and algB51 | This study |
| pUS63 | pUS66 + 1.5-kb BamHI fragment of pUCGM; ΔalgB::ΩaacC1 | This study |
| pUS65 | pEX100T + 5.1-kb EcoRI-ClaI fragment of pUS63; ΔalgB::ΩaacC1 | This study |
| pUS66 | pUS61 cleaved with BglII and the 1.8-kb algB fragment deleted; ΔalgB | This study |
| pUS68 | pEX100T + 2.9-kb HindIII-EcoRI fragment of pUS66; ΔalgB | This study |
| pUS69 | pUS68 + 2.1-kb KpnI-XhoI fragment of pDJW17; algB+ | This study |
| pUS150 | pEX100T + 2.7-kb SalI fragment from pDJW106; algR | This study |
| pUS152 | pDJW106 mutagenized with oligonucleotide algR7 | This study |
| pUS157 | pEX100T + 2.7-kb SalI fragment from pUS152; algR7 | This study |
| pUS164 | pDJW106 mutagenized with oligonucleotide algR10 | This study |
| pUS165 | pDJW106 mutagenized with oligonucleotides algR7 and algR10; algR11 | This study |
| pUS166 | pDJW525 + 2.7-kb SalI fragment from pUS164; algR10 | This study |
| pUS168 | pDJW525 + 2.7-kb SalI fragment from pUS165; algR11 | This study |
| Oligonucleotides | ||
| algB45 | GGCGCAGGTTGAGGAAGCAa | This study |
| algB48 | TGCTTGCGCTTCTCGTACAGGGTCGAa | This study |
| algB50 | TTCGCTACCCAGATCTGCCTGGCCCCa | This study |
| algB51 | ACCGGGTCCAGATCTTCATCGGa | This study |
| algB52 | CGGGATCCATGGAAACCACTTCC | This study |
| algB53 | CGGAATTCATCGGCAGCGGC | This study |
| algB54 | CGGGATCCTGGAATCGCACAGGCC | This study |
| algR5 | CGGCACTAGATCTGTCTACGa | This study |
| algR6 | GCATCAGATCTGACGGCa | This study |
| algR7 | GTCCTGCTGAATATCCGCAa | This study |
| algR10 | ACGGCCCATAACGAATTCGa | This study |
| algR11 | GAAGCGCTGACGCTGAT | This study |
| algR12 | TCGCTGCGCACCGGCTTGA | This study |
| kinBP7 | CTCGACAGCATCGACGACGG | This study |
| kinBP10 | CGCTATGCCCGCCGGGATGG | This study |
a
Mutagenic oligonucleotide (underlined residue[s] represents altered nucleotide).