Skip to main content
. 1998 Feb;180(4):989–993. doi: 10.1128/jb.180.4.989-993.1998

TABLE 1.

E. coli K-12 strains and plasmids

Strain or plasmid Relevant genotype or characteristics Reference, source, or construction
E. coli strains
 AB1157 F−thr-1 ara-14 leuB6 Δ(gpt-proA)62 lacY1 tsx-33 supE44 galK2 hisG4 rfbD1 mgl-51 rpsL31 kdgK51 xyl-5 mtl-1 argE3 thi-1 1
 JC11450 AB1157, spontaneous Su− A. J. Clark
 FC40 ara Δ(lac-proAB)XIIIthi Rifr [F′ proAB+ lacI33ΩlacZ] 3
 CAG12176 zef-3189::Tn10kan 33
 CAG18604 zgf-3156::Tn10kan 33
 STL160 AB1157 Δ(xseA-guaB) zfh-3139::Tn10kan S. T. Lovett
 SMR91 mutL211::Tn5 Laboratory collection
 SMR423 recD1903::Tn10 Laboratory collection
 SMR690 FC40 recJ284::Tn10 10
 SMR838 JC11450 ΔxonA300::cat his+ Laboratory collection
 SMR839 JC11450 ΔxonA300::cat 27
 SMR1403 JC11450 ΔxonA300::cat recJ284::Tn10 27
 SMR2597 FC40 Δ(xseA-guaB) zfh-3139::Tn10kan Laboratory collection
 SMR3070 FC40 ΔxonA300::cat FC40 × P1(SMR839)
 SMR3404 FC40 mutL211::Tn5 FC40 × P1(SMR91)
 SMR3465 recD1903::Tn10 ΔxseA18::amp This studya
 SMR3472 FC40 ΔxseA18::amp SMR2597 × P1(SMR3465)b
 SMR3481 FC40 ΔxonA300::cat recJ284::Tn10 ΔxseA18::amp FC40 × P1(SMR838), P1(SMR690), P1(SMR3472)c
 SMR3488 JC11450 ΔxonA300::cat recJ284::Tn10 ΔxseA18::amp SMR1403 × P1(SMR3472)c
 SMR3524 JC11450 mutL211::Tn5 JC11450 × P1 (SMR3404)
 SMR4035 FC40 ΔxonA300::cat zef-3189::Tn10kan SMR3070 × P1(CAG12176)
 SMR4036 FC40 recJ284::Tn10 zgf-3156::Tn10kan SMR690 × P1(CAG18604)
 SMR4037 FC40 ΔxseA18::amp zfh-3139::Tn10kan SMR3472 × P1(STL160)
Plasmids
 pMJ3 pACYC184 derivative containing xseA and guaBA This studyd
 pMJ6 pMJ3 derivative containing ΔxseA18::amp This studye
a

Constructed by transforming SMR423 with the 5-kb AvaI-BamHI fragment of pMJ6 which contains ΔxseA18::amp and selecting ampicillin-resistant transformants (29). 

b

This transduction confirmed the chromosomal location of ΔxseA18::amp, as all Ampr transductants were Gua+ and the expected linkage to zfh-3139::Tn10kan (4) was observed. 

c

The presence of the null alleles in the triple mutants was confirmed by P1 transduction of each mutation into genetic backgrounds in which the following characteristic phenotypes were observed: recJ284::Tn10 makes recB21 recC22 sbcB15 sbcC201 strains extremely UV sensitive (16); xonA-null mutations decrease transductional recombination via the RecF pathway (2); and xseA mutations enhance sensitivity to low concentrations of nalidixic acid (4). The triple mutants also display UV light sensitivity (discussed in the text), as expected from their reduced-recombination phenotype (27). 

d

A 5-kb BglI-BamHI fragment from Kohara phage λ427 (λ8E3) (11) containing xseA and guaBA was ligated into BglI-BamHI-digested pACYC184 (see, e.g., reference 21). BglI 3′ overhangs were removed with T4 DNA polymerase (exonuclease activity) prior to ligation. 

e

The 690-bp EagI-AflII fragment of xseA (6) (GenBank accession no., J02599) was replaced with an EagI-AflII-digested 1,035-bp PCR fragment containing the bla gene of pBR322 (see, e.g., reference 21). bla was amplified with primers that create EagI and AflII sites (EagI primer: 5′GTACGGCCGAGTAAACTTGGTCTGACA; AflII primer: 5′ATGCTTAAGTAGACGTCAGGTGGCACT).