FIG. 2.
Central regions of the O-antigen gene clusters of S. enterica groups D1, D2, D3, and B. N, O, U, and V indicate genes wbaN, -O, -U and -V, respectively. Mannose, rhamnose (transferase only shown), DDH, and wzx genes are indicated by shading. Heavy bars above and below indicate transferase genes. Level of shading indicates degree of amino acid identity to homologous gene of group D1. Note that wbaO has barely detectable amino acid identity to wbaU. The wbaV-wbaU intergenic region of groups B and D1, shown to be remnant wzy genes, are indicated by a cross-out on the wzy gene. The similarities of the D3 cluster are indicated. The insert of plasmid pPR1739 is indicated, as are the binding sites for primers 365, 16, and 20, used for PCR of D3 DNA; primer 365 (TAGAATTCAAAGGGCTGGCTAGCTACA) is based on group D2 sequence (positions 314 to 332) (40), while primers 16 (GCGGTAGGCTTTAGAATA) and 20 (CTCTTGGAATCCAGAACG) are based on sequences of group B (positions 16160 to 16143 and 17238 to 17221, respectively) (13). The 5′ end of all four clusters (not shown) comprises rhamnose genes (rmlABCD) and DDH genes (ddhABCD), and the 3′ end comprises mannose genes (manBC) and the wbaP gene (not shown).
